EMAIL THIS PAGE TO A FRIEND

AES

amino-terminal enhancer of split

Synonyms: AES-1 AES-2 ESP1 GRG GRG5 TLE5
UniProtKB ID: Q08117, B2RBL0, Q12808, Q14CJ1, Q96TG9, Q9UDY9
Gene ID:
Human(166) Summary: The protein encoded by this gene is similar in sequence to the amino terminus of Drosophila enhancer of split groucho, a protein involved in neurogenesis during embryonic development. The encoded protein, which belongs to the groucho/TLE family of proteins, can function as a homooligomer or as a heteroologimer with other family members to dominantly repress the expression of other family member genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14797) amino-terminal enhancer of split
Rat(29466) amino-terminal enhancer of split
Zebrafish(393395) amino-terminal enhancer of split
cow(505375) amino-terminal enhancer of split
domestic cat(101083243) amino-terminal enhancer of split
dog(485064) amino-terminal enhancer of split
chicken(100858542) amino-terminal enhancer of split
sheep(101119474) amino-terminal enhancer of split
domestic guinea pig(101788509) amino-terminal enhancer of split
naked mole-rat(101722861) amino-terminal enhancer of split
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079841 MISSION® esiRNA esiRNA human AES (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001130 Rosetta Predictions human pricing
NM_198969 Rosetta Predictions human pricing
NM_198970 Rosetta Predictions human pricing
NM_019220 Rosetta Predictions rat pricing
NM_010347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136048 predicted 1028
2 SASI_Hs01_00136049 predicted 1146
3 SASI_Hs01_00136050 predicted 1054
4 SASI_Hs01_00136051 predicted 1145
5 SASI_Hs01_00136052 predicted 1016
6 SASI_Hs01_00136053 predicted 1031
7 SASI_Hs01_00136054 predicted 1153
8 SASI_Hs01_00136055 predicted 1046
9 SASI_Hs01_00136047 predicted 1139
10 SASI_Hs02_00331217 predicted 865
11 SASI_Hs01_00136056 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069193 predicted 1090
2 SASI_Hs01_00069194 predicted 1220
3 SASI_Hs01_00069195 predicted 1122
4 SASI_Hs01_00069196 predicted 1205
5 SASI_Hs01_00069197 predicted 1096
6 SASI_Hs01_00069198 predicted 1217
7 SASI_Hs01_00069199 predicted 1115
8 SASI_Hs01_00069192 predicted 1210
9 SASI_Hs01_00069201 predicted 925
10 SASI_Hs02_00372483 predicted 1328
11 SASI_Hs01_00069200 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111975 predicted 858
2 SASI_Hs01_00111976 predicted 860
3 SASI_Hs01_00111978 predicted 850
4 SASI_Hs02_00372484 predicted 820
5 SASI_Hs01_00111979 predicted 860
6 SASI_Hs01_00111980 predicted 1144
7 SASI_Hs01_00111981 predicted 1013
8 SASI_Hs01_00111982 predicted 975
9 SASI_Hs01_00111983 predicted 1002
10 SASI_Hs02_00372485 predicted 1149
11 SASI_Hs01_00111974 predicted 1144
12 SASI_Hs01_00111977 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066370 predicted 318
2 SASI_Rn01_00066371 predicted 291
3 SASI_Rn01_00066372 predicted 305
4 SASI_Rn01_00066373 predicted 360
5 SASI_Rn01_00066375 predicted 309
6 SASI_Rn01_00066376 predicted 338
7 SASI_Rn01_00066377 predicted 397
8 SASI_Rn01_00066378 predicted 320
9 SASI_Rn01_00066379 predicted 352
10 SASI_Rn02_00262073 predicted 334
11 SASI_Rn01_00066374 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139428 predicted 428
2 SASI_Mm02_00318365 predicted 243
3 SASI_Mm01_00139429 predicted 248
4 SASI_Mm01_00139431 predicted 352
5 SASI_Mm01_00139432 predicted 313
6 SASI_Mm02_00318366 predicted 204
7 SASI_Mm01_00139433 predicted 250
8 SASI_Mm02_00318367 predicted 1119
9 SASI_Mm01_00139434 predicted 359
10 SASI_Mm01_00139435 predicted 300
11 SASI_Mm01_00139427 predicted 245
12 SASI_Mm01_00139430 predicted 209
13 SASI_Mm01_00139436 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130
AES MISSION shRNA Bacterial Glycerol Stock
amino-terminal enhancer of split
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-264s1c1
Sequence:CCGGGACGAATTTCAGCTACTGCAACTCGAGTTGCAGTAGCTGAAATTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-302s1c1
Sequence:CCGGCAAGCTCGAATGTGACAAGTTCTCGAGAACTTGTCACATTCGAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-746s1c1
Sequence:CCGGTGATGGCGAGAAGTCGGATTACTCGAGTAATCCGACTTCTCGCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-377s1c1
Sequence:CCGGCTACGGCTTGAACATCGAGATCTCGAGATCTCGATGTTCAAGCCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-527s1c1
Sequence:CCGGGCTGAACTCTATCATCCGACACTCGAGTGTCGGATGATAGAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130.5-1155s21c1
Sequence:CCGGTGGTACTGCATGCACGCAATGCTCGAGCATTGCGTGCATGCAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130.5-869s21c1
Sequence:CCGGGCTAAACTCCCATAGTATTTACTCGAGTAAATACTATGGGAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130
AES MISSION shRNA shRNA Plasmid DNA
amino-terminal enhancer of split
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-264s1c1
Sequence:CCGGGACGAATTTCAGCTACTGCAACTCGAGTTGCAGTAGCTGAAATTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-302s1c1
Sequence:CCGGCAAGCTCGAATGTGACAAGTTCTCGAGAACTTGTCACATTCGAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-746s1c1
Sequence:CCGGTGATGGCGAGAAGTCGGATTACTCGAGTAATCCGACTTCTCGCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-377s1c1
Sequence:CCGGCTACGGCTTGAACATCGAGATCTCGAGATCTCGATGTTCAAGCCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-527s1c1
Sequence:CCGGGCTGAACTCTATCATCCGACACTCGAGTGTCGGATGATAGAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130.5-1155s21c1
Sequence:CCGGTGGTACTGCATGCACGCAATGCTCGAGCATTGCGTGCATGCAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130.5-869s21c1
Sequence:CCGGGCTAAACTCCCATAGTATTTACTCGAGTAAATACTATGGGAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130
AES MISSION shRNA Lentiviral Transduction Particles
amino-terminal enhancer of split
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-264s1c1
Sequence:CCGGGACGAATTTCAGCTACTGCAACTCGAGTTGCAGTAGCTGAAATTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-302s1c1
Sequence:CCGGCAAGCTCGAATGTGACAAGTTCTCGAGAACTTGTCACATTCGAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-746s1c1
Sequence:CCGGTGATGGCGAGAAGTCGGATTACTCGAGTAATCCGACTTCTCGCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-377s1c1
Sequence:CCGGCTACGGCTTGAACATCGAGATCTCGAGATCTCGATGTTCAAGCCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001130.5-527s1c1
Sequence:CCGGGCTGAACTCTATCATCCGACACTCGAGTGTCGGATGATAGAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130.5-1155s21c1
Sequence:CCGGTGGTACTGCATGCACGCAATGCTCGAGCATTGCGTGCATGCAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130.5-869s21c1
Sequence:CCGGGCTAAACTCCCATAGTATTTACTCGAGTAAATACTATGGGAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010347
VALIDATED
AES MISSION shRNA Bacterial Glycerol Stock
amino-terminal enhancer of split
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-854s1c1
Sequence:CCGGCCCAGAATGTACACAACGCTACTCGAGTAGCGTTGTGTACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-108s1c1
Sequence:CCGGCGACTCCTGTGACCGCATCAACTCGAGTTGATGCGGTCACAGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-214s1c1
Sequence:CCGGAGGCATTACGTCATGTACTATCTCGAGATAGTACATGACGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-612s1c1
Sequence:CCGGTGACGGAGAGAAGTCGGATTACTCGAGTAATCCGACTTCTCTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-243s1c1
Sequence:CCGGCTACGGATTGAACATCGAGATCTCGAGATCTCGATGTTCAATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010347
VALIDATED
AES MISSION shRNA shRNA Plasmid DNA
amino-terminal enhancer of split
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-854s1c1
Sequence:CCGGCCCAGAATGTACACAACGCTACTCGAGTAGCGTTGTGTACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-108s1c1
Sequence:CCGGCGACTCCTGTGACCGCATCAACTCGAGTTGATGCGGTCACAGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-214s1c1
Sequence:CCGGAGGCATTACGTCATGTACTATCTCGAGATAGTACATGACGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-612s1c1
Sequence:CCGGTGACGGAGAGAAGTCGGATTACTCGAGTAATCCGACTTCTCTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-243s1c1
Sequence:CCGGCTACGGATTGAACATCGAGATCTCGAGATCTCGATGTTCAATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010347
VALIDATED
AES MISSION shRNA Lentiviral Transduction Particles
amino-terminal enhancer of split
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-854s1c1
Sequence:CCGGCCCAGAATGTACACAACGCTACTCGAGTAGCGTTGTGTACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-108s1c1
Sequence:CCGGCGACTCCTGTGACCGCATCAACTCGAGTTGATGCGGTCACAGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-214s1c1
Sequence:CCGGAGGCATTACGTCATGTACTATCTCGAGATAGTACATGACGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-612s1c1
Sequence:CCGGTGACGGAGAGAAGTCGGATTACTCGAGTAATCCGACTTCTCTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010347.1-243s1c1
Sequence:CCGGCTACGGATTGAACATCGAGATCTCGAGATCTCGATGTTCAATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks