EMAIL THIS PAGE TO A FRIEND

AFAP1

actin filament associated protein 1

107 Gene Product Result for
Synonyms: AFAP AFAP-110 AFAP110
UniProtKB ID: Q8N556, A8K442, B4DMU2, E9PDT7, Q59EY5, Q9HBY1
Gene ID:
Human(60312) Summary: The protein encoded by this gene is a Src binding partner. It may represent a potential modulator of actin filament integrity in response to cellular signals, and may function as an adaptor protein by linking Src family members and/or other signaling proteins to actin filaments. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(70292) actin filament associated protein 1
Rat(140935) actin filament associated protein 1
Zebrafish(568356) actin filament associated protein 1
chicken(374034) actin filament associated protein 1
dog(488786) actin filament associated protein 1
domestic cat(101098868) actin filament associated protein 1
cow(534032) actin filament associated protein 1
Horse(100056653) actin filament associated protein 1
naked mole-rat(101717414) actin filament associated protein 1
domestic guinea pig(100735141) actin filament associated protein 1
sheep(101109449) actin filament associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021638 Rosetta Predictions human pricing
NM_198595 Rosetta Predictions human pricing
NM_080900 Rosetta Predictions rat pricing
NM_027373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168700 predicted 722
2 SASI_Hs01_00168701 predicted 568
3 SASI_Hs01_00168702 predicted 1848
4 SASI_Hs01_00168703 predicted 816
5 SASI_Hs01_00168705 predicted 1947
6 SASI_Hs01_00168706 predicted 697
7 SASI_Hs01_00168707 predicted 1255
8 SASI_Hs02_00354998 predicted 1579
9 SASI_Hs01_00168708 predicted 1467
10 SASI_Hs01_00168709 predicted 1878
11 SASI_Hs01_00168704 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127105 predicted 773
2 SASI_Hs01_00127106 predicted 626
3 SASI_Hs01_00127107 predicted 1910
4 SASI_Hs01_00127108 predicted 869
5 SASI_Hs01_00127110 predicted 1994
6 SASI_Hs01_00127111 predicted 756
7 SASI_Hs01_00127112 predicted 1302
8 SASI_Hs02_00372240 predicted 1635
9 SASI_Hs01_00127113 predicted 1524
10 SASI_Hs01_00127114 predicted 1935
11 SASI_Hs01_00127109 predicted 1607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090430 predicted 1052
2 SASI_Rn02_00267354 predicted 1632
3 SASI_Rn01_00090431 predicted 431
4 SASI_Rn01_00090432 predicted 974
5 SASI_Rn01_00090433 predicted 1005
6 SASI_Rn01_00090434 predicted 1641
7 SASI_Rn01_00090435 predicted 1395
8 SASI_Rn01_00090436 predicted 472
9 SASI_Rn01_00090437 predicted 425
10 SASI_Rn01_00090438 predicted 265
11 SASI_Rn01_00090439 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332054 predicted 346
2 SASI_Mm02_00332055 predicted 1195
3 SASI_Mm02_00332056 predicted 697
4 SASI_Mm02_00332057 predicted 2505
5 SASI_Mm02_00332058 predicted 1065
6 SASI_Mm02_00332059 predicted 1480
7 SASI_Mm02_00332060 predicted 1130
8 SASI_Mm02_00332061 predicted 1736
9 SASI_Mm02_00332062 predicted 1850
10 SASI_Mm02_00332063 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027373
AFAP1 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027373.2-2609s21c1
Sequence:CCGGGTGTCCAAATTTACTTGTTAACTCGAGTTAACAAGTAAATTTGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027373.2-756s21c1
Sequence:CCGGACCAAGCTGCTGTGCTATAAACTCGAGTTTATAGCACAGCAGCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027373.1-2437s1c1
Sequence:CCGGCCCAGAGACTGTGTACTGCCACTCGAGTGGCAGTACACAGTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-537s1c1
Sequence:CCGGCCAGAGTACATCACCTCAAATCTCGAGATTTGAGGTGATGTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-935s1c1
Sequence:CCGGGCAGTGGTTGAAGGTAATCAACTCGAGTTGATTACCTTCAACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-489s1c1
Sequence:CCGGCCAGAGGGTTACTATGAGGAACTCGAGTTCCTCATAGTAACCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-1880s1c1
Sequence:CCGGGCAGTACAAATATGGGAAGAACTCGAGTTCTTCCCATATTTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027373
AFAP1 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027373.2-2609s21c1
Sequence:CCGGGTGTCCAAATTTACTTGTTAACTCGAGTTAACAAGTAAATTTGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027373.2-756s21c1
Sequence:CCGGACCAAGCTGCTGTGCTATAAACTCGAGTTTATAGCACAGCAGCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027373.1-2437s1c1
Sequence:CCGGCCCAGAGACTGTGTACTGCCACTCGAGTGGCAGTACACAGTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-537s1c1
Sequence:CCGGCCAGAGTACATCACCTCAAATCTCGAGATTTGAGGTGATGTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-935s1c1
Sequence:CCGGGCAGTGGTTGAAGGTAATCAACTCGAGTTGATTACCTTCAACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-489s1c1
Sequence:CCGGCCAGAGGGTTACTATGAGGAACTCGAGTTCCTCATAGTAACCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-1880s1c1
Sequence:CCGGGCAGTACAAATATGGGAAGAACTCGAGTTCTTCCCATATTTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027373
AFAP1 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027373.2-2609s21c1
Sequence:CCGGGTGTCCAAATTTACTTGTTAACTCGAGTTAACAAGTAAATTTGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027373.2-756s21c1
Sequence:CCGGACCAAGCTGCTGTGCTATAAACTCGAGTTTATAGCACAGCAGCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027373.1-2437s1c1
Sequence:CCGGCCCAGAGACTGTGTACTGCCACTCGAGTGGCAGTACACAGTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-537s1c1
Sequence:CCGGCCAGAGTACATCACCTCAAATCTCGAGATTTGAGGTGATGTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-935s1c1
Sequence:CCGGGCAGTGGTTGAAGGTAATCAACTCGAGTTGATTACCTTCAACCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-489s1c1
Sequence:CCGGCCAGAGGGTTACTATGAGGAACTCGAGTTCCTCATAGTAACCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027373.1-1880s1c1
Sequence:CCGGGCAGTACAAATATGGGAAGAACTCGAGTTCTTCCCATATTTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021638
VALIDATED
AFAP1 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021638.3-1413s1c1
Sequence:CCGGCCGGGTTTGGATTCTAAACATCTCGAGATGTTTAGAATCCAAACCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021638.3-485s1c1
Sequence:CCGGCCCAGAAGGTTATTATGAGGACTCGAGTCCTCATAATAACCTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-486s1c1
Sequence:CCGGCCAGAAGGTTATTATGAGGAACTCGAGTTCCTCATAATAACCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021638.3-534s1c1
Sequence:CCGGCCGGAATACATCACATCAAATCTCGAGATTTGATGTGATGTATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-255s1c1
Sequence:CCGGGAACTCCTGGACCATGAATATCTCGAGATATTCATGGTCCAGGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021638.3-812s1c1
Sequence:CCGGCCAAGGCTGTAACATTACGTACTCGAGTACGTAATGTTACAGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-1640s1c1
Sequence:CCGGCAGGCGTGTTATATCTGCTAACTCGAGTTAGCAGATATAACACGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021638
VALIDATED
AFAP1 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021638.3-1413s1c1
Sequence:CCGGCCGGGTTTGGATTCTAAACATCTCGAGATGTTTAGAATCCAAACCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021638.3-485s1c1
Sequence:CCGGCCCAGAAGGTTATTATGAGGACTCGAGTCCTCATAATAACCTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-486s1c1
Sequence:CCGGCCAGAAGGTTATTATGAGGAACTCGAGTTCCTCATAATAACCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021638.3-534s1c1
Sequence:CCGGCCGGAATACATCACATCAAATCTCGAGATTTGATGTGATGTATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-255s1c1
Sequence:CCGGGAACTCCTGGACCATGAATATCTCGAGATATTCATGGTCCAGGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021638.3-812s1c1
Sequence:CCGGCCAAGGCTGTAACATTACGTACTCGAGTACGTAATGTTACAGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-1640s1c1
Sequence:CCGGCAGGCGTGTTATATCTGCTAACTCGAGTTAGCAGATATAACACGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021638
VALIDATED
AFAP1 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021638.3-1413s1c1
Sequence:CCGGCCGGGTTTGGATTCTAAACATCTCGAGATGTTTAGAATCCAAACCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021638.3-485s1c1
Sequence:CCGGCCCAGAAGGTTATTATGAGGACTCGAGTCCTCATAATAACCTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-486s1c1
Sequence:CCGGCCAGAAGGTTATTATGAGGAACTCGAGTTCCTCATAATAACCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021638.3-534s1c1
Sequence:CCGGCCGGAATACATCACATCAAATCTCGAGATTTGATGTGATGTATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-255s1c1
Sequence:CCGGGAACTCCTGGACCATGAATATCTCGAGATATTCATGGTCCAGGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021638.3-812s1c1
Sequence:CCGGCCAAGGCTGTAACATTACGTACTCGAGTACGTAATGTTACAGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021638.3-1640s1c1
Sequence:CCGGCAGGCGTGTTATATCTGCTAACTCGAGTTAGCAGATATAACACGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)