EMAIL THIS PAGE TO A FRIEND

AFAP1L1

actin filament associated protein 1-like 1

UniProtKB ID: Q8TED9, Q08AN4, Q08AN5, Q8IW82, Q8N8Z5, Q8N9Q4
Gene ID:
Mouse(106877) actin filament associated protein 1-like 1
Rat(291565) actin filament associated protein 1-like 1
chicken(427621) actin filament associated protein 1-like 1
dog(489196) actin filament associated protein 1-like 1
cow(510738) actin filament associated protein 1-like 1
domestic cat(101088217) actin filament associated protein 1-like 1
sheep(101119212) actin filament associated protein 1-like 1
Domestic Rabbit(100339968) actin filament associated protein 1-like 1
domestic guinea pig(100734102) actin filament associated protein 1-like 1
naked mole-rat(101712764) actin filament associated protein 1-like 1
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500747 Anti-AFAP1L1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_059702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_059702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_059702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152406 Rosetta Predictions human pricing
NM_001106142 Rosetta Predictions rat pricing
NM_178928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034269 predicted 1738
2 SASI_Hs01_00034270 predicted 481
3 SASI_Hs02_00366094 predicted 1258
4 SASI_Hs01_00034271 predicted 590
5 SASI_Hs01_00034273 predicted 294
6 SASI_Hs01_00034274 predicted 602
7 SASI_Hs01_00034275 predicted 2306
8 SASI_Hs01_00034276 predicted 523
9 SASI_Hs01_00034277 predicted 1633
10 SASI_Hs01_00034278 predicted 617
11 SASI_Hs01_00034272 predicted 2121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216038 predicted 2402
2 SASI_Rn02_00216039 predicted 2449
3 SASI_Rn02_00216040 predicted 2050
4 SASI_Rn02_00216041 predicted 1757
5 SASI_Rn02_00216042 predicted 2286
6 SASI_Rn02_00216043 predicted 733
7 SASI_Rn02_00216044 predicted 511
8 SASI_Rn02_00216045 predicted 295
9 SASI_Rn02_00216046 predicted 1703
10 SASI_Rn02_00216047 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053163 predicted 1730
2 SASI_Mm01_00053164 predicted 2032
3 SASI_Mm01_00053167 predicted 483
4 SASI_Mm01_00053168 predicted 1956
5 SASI_Mm01_00053169 predicted 1202
6 SASI_Mm01_00053170 predicted 1134
7 SASI_Mm01_00053171 predicted 2212
8 SASI_Mm02_00349559 predicted 1337
9 SASI_Mm02_00349560 predicted 532
10 SASI_Mm02_00349561 predicted 1245
11 SASI_Mm01_00053162 predicted 1399
12 SASI_Mm01_00053165 predicted 274
13 SASI_Mm01_00053166 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_059702
VALIDATED
AFAP1L1 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1-like 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000008582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059702.8-30s1c1
Sequence:CCGGCCTTACATCAATAAAGCAGAACTCGAGTTCTGCTTTATTGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_059702.8-1963s1c1
Sequence:CCGGAGTGCCAATCAATACAAGTATCTCGAGATACTTGTATTGATTGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059702.8-3942s1c1
Sequence:CCGGCCCAAGATTGTTGGGAAGATTCTCGAGAATCTTCCCAACAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059702.8-1338s1c1
Sequence:CCGGCCGTATCATTGGCTTCTCCAACTCGAGTTGGAGAAGCCAATGATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_059702
VALIDATED
AFAP1L1 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1-like 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000008582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059702.8-30s1c1
Sequence:CCGGCCTTACATCAATAAAGCAGAACTCGAGTTCTGCTTTATTGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_059702.8-1963s1c1
Sequence:CCGGAGTGCCAATCAATACAAGTATCTCGAGATACTTGTATTGATTGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059702.8-3942s1c1
Sequence:CCGGCCCAAGATTGTTGGGAAGATTCTCGAGAATCTTCCCAACAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059702.8-1338s1c1
Sequence:CCGGCCGTATCATTGGCTTCTCCAACTCGAGTTGGAGAAGCCAATGATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_059702
VALIDATED
AFAP1L1 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1-like 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000008582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059702.8-30s1c1
Sequence:CCGGCCTTACATCAATAAAGCAGAACTCGAGTTCTGCTTTATTGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_059702.8-1963s1c1
Sequence:CCGGAGTGCCAATCAATACAAGTATCTCGAGATACTTGTATTGATTGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059702.8-3942s1c1
Sequence:CCGGCCCAAGATTGTTGGGAAGATTCTCGAGAATCTTCCCAACAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059702.8-1338s1c1
Sequence:CCGGCCGTATCATTGGCTTCTCCAACTCGAGTTGGAGAAGCCAATGATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178928
AFAP1L1 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000105707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-1735s1c1
Sequence:CCGGGCATCTACGATGAGGTTCCTTCTCGAGAAGGAACCTCATCGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-488s1c1
Sequence:CCGGCGAGTATATCAGCTCTCACAACTCGAGTTGTGAGAGCTGATATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178928.3-3008s1c1
Sequence:CCGGGCTGGAAGTATGGAGTGCTAACTCGAGTTAGCACTCCATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-621s1c1
Sequence:CCGGGCCATGAGTAGCTCCTATGAACTCGAGTTCATAGGAGCTACTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178928
AFAP1L1 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000105707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-1735s1c1
Sequence:CCGGGCATCTACGATGAGGTTCCTTCTCGAGAAGGAACCTCATCGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-488s1c1
Sequence:CCGGCGAGTATATCAGCTCTCACAACTCGAGTTGTGAGAGCTGATATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178928.3-3008s1c1
Sequence:CCGGGCTGGAAGTATGGAGTGCTAACTCGAGTTAGCACTCCATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-621s1c1
Sequence:CCGGGCCATGAGTAGCTCCTATGAACTCGAGTTCATAGGAGCTACTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178928
AFAP1L1 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000105707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-1735s1c1
Sequence:CCGGGCATCTACGATGAGGTTCCTTCTCGAGAAGGAACCTCATCGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-488s1c1
Sequence:CCGGCGAGTATATCAGCTCTCACAACTCGAGTTGTGAGAGCTGATATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178928.3-3008s1c1
Sequence:CCGGGCTGGAAGTATGGAGTGCTAACTCGAGTTAGCACTCCATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178928.3-621s1c1
Sequence:CCGGGCCATGAGTAGCTCCTATGAACTCGAGTTCATAGGAGCTACTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152406
VALIDATED
AFAP1L1 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1703s21c1
Sequence:CCGGCGTGGATGTGGAGACCTTAACCTCGAGGTTAAGGTCTCCACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-2897s21c1
Sequence:CCGGCTTGATTCATATTGGGCATTACTCGAGTAATGCCCAATATGAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-652s21c1
Sequence:CCGGAGCTTAAGAGCTCCTATAATGCTCGAGCATTATAGGAGCTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152406.2-1741s21c1
Sequence:CCGGGGCGCAACTCCTTCCTATATGCTCGAGCATATAGGAAGGAGTTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1942s21c1
Sequence:CCGGGTGCCAATCAATACAAGTATGCTCGAGCATACTTGTATTGATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152406.2-2796s21c1
Sequence:CCGGCATCGCACTCCCAGTCCTTAACTCGAGTTAAGGACTGGGAGTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-331s21c1
Sequence:CCGGGCTTCGTGGAATCCCTCTTTGCTCGAGCAAAGAGGGATTCCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1909s21c1
Sequence:CCGGACCCGCAGGTCAAAGTCAAACCTCGAGGTTTGACTTTGACCTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152406
VALIDATED
AFAP1L1 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1703s21c1
Sequence:CCGGCGTGGATGTGGAGACCTTAACCTCGAGGTTAAGGTCTCCACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-2897s21c1
Sequence:CCGGCTTGATTCATATTGGGCATTACTCGAGTAATGCCCAATATGAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-652s21c1
Sequence:CCGGAGCTTAAGAGCTCCTATAATGCTCGAGCATTATAGGAGCTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152406.2-1741s21c1
Sequence:CCGGGGCGCAACTCCTTCCTATATGCTCGAGCATATAGGAAGGAGTTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1942s21c1
Sequence:CCGGGTGCCAATCAATACAAGTATGCTCGAGCATACTTGTATTGATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152406.2-2796s21c1
Sequence:CCGGCATCGCACTCCCAGTCCTTAACTCGAGTTAAGGACTGGGAGTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-331s21c1
Sequence:CCGGGCTTCGTGGAATCCCTCTTTGCTCGAGCAAAGAGGGATTCCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1909s21c1
Sequence:CCGGACCCGCAGGTCAAAGTCAAACCTCGAGGTTTGACTTTGACCTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152406
VALIDATED
AFAP1L1 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1703s21c1
Sequence:CCGGCGTGGATGTGGAGACCTTAACCTCGAGGTTAAGGTCTCCACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-2897s21c1
Sequence:CCGGCTTGATTCATATTGGGCATTACTCGAGTAATGCCCAATATGAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-652s21c1
Sequence:CCGGAGCTTAAGAGCTCCTATAATGCTCGAGCATTATAGGAGCTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152406.2-1741s21c1
Sequence:CCGGGGCGCAACTCCTTCCTATATGCTCGAGCATATAGGAAGGAGTTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1942s21c1
Sequence:CCGGGTGCCAATCAATACAAGTATGCTCGAGCATACTTGTATTGATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152406.2-2796s21c1
Sequence:CCGGCATCGCACTCCCAGTCCTTAACTCGAGTTAAGGACTGGGAGTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-331s21c1
Sequence:CCGGGCTTCGTGGAATCCCTCTTTGCTCGAGCAAAGAGGGATTCCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152406.2-1909s21c1
Sequence:CCGGACCCGCAGGTCAAAGTCAAACCTCGAGGTTTGACTTTGACCTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks