EMAIL THIS PAGE TO A FRIEND

AFAP1L2

actin filament associated protein 1-like 2

Synonyms: KIAA1914 XB130
Gene ID:
Mouse(226250) actin filament associated protein 1-like 2
Rat(292130) actin filament associated protein 1-like 2
Zebrafish(567369) actin filament associated protein 1-like 2
chicken(423908) actin filament associated protein 1-like 2
domestic cat(101081930) actin filament associated protein 1-like 2
Horse(100068108) actin filament associated protein 1-like 2
dog(486898) actin filament associated protein 1-like 2
cow(615436) actin filament associated protein 1-like 2
naked mole-rat(101704500) actin filament associated protein 1-like 2
domestic guinea pig(100713764) actin filament associated protein 1-like 2
sheep(101119095) actin filament associated protein 1-like 2
Domestic Rabbit(100338340) actin filament associated protein 1-like 2
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032550 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001936 Rosetta Predictions human pricing
NM_032550 Rosetta Predictions human pricing
XM_001064140 Rosetta Predictions rat pricing
XM_217643 Rosetta Predictions rat pricing
NM_146102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153749 predicted 1718
2 SASI_Hs01_00153750 predicted 1183
3 SASI_Hs01_00153751 predicted 2366
4 SASI_Hs01_00153752 predicted 843
5 SASI_Hs01_00153753 predicted 1025
6 SASI_Hs01_00153754 predicted 443
7 SASI_Hs01_00153755 predicted 1650
8 SASI_Hs01_00153756 predicted 1360
9 SASI_Hs01_00153757 predicted 1892
10 SASI_Hs02_00304019 predicted 662
11 SASI_Hs01_00153748 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241922 predicted 1723
2 SASI_Hs01_00241923 predicted 1179
3 SASI_Hs01_00241924 predicted 2363
4 SASI_Hs01_00241925 predicted 848
5 SASI_Hs01_00241926 predicted 1027
6 SASI_Hs01_00241927 predicted 449
7 SASI_Hs01_00241928 predicted 1646
8 SASI_Hs01_00241929 predicted 1359
9 SASI_Hs01_00241930 predicted 1888
10 SASI_Hs02_00360062 predicted 662
11 SASI_Hs01_00241921 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309447 predicted 2606
2 SASI_Rn02_00309448 predicted 1288
3 SASI_Rn02_00309449 predicted 806
4 SASI_Rn02_00309450 predicted 1140
5 SASI_Rn02_00309451 predicted 458
6 SASI_Rn02_00309452 predicted 590
7 SASI_Rn02_00309453 predicted 814
8 SASI_Rn02_00309454 predicted 2581
9 SASI_Rn02_00309455 predicted 2573
10 SASI_Rn02_00309456 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377285 predicted 232
2 SASI_Rn02_00377286 predicted 472
3 SASI_Rn02_00377287 predicted 1288
4 SASI_Rn02_00377288 predicted 804
5 SASI_Rn02_00377289 predicted 1143
6 SASI_Rn02_00377290 predicted 1484
7 SASI_Rn02_00377291 predicted 410
8 SASI_Rn02_00377292 predicted 457
9 SASI_Rn02_00377293 predicted 592
10 SASI_Rn02_00377294 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077698 predicted 1288
2 SASI_Mm01_00077699 predicted 1106
3 SASI_Mm01_00077700 predicted 568
4 SASI_Mm01_00077701 predicted 2534
5 SASI_Mm01_00077702 predicted 607
6 SASI_Mm01_00077703 predicted 1426
7 SASI_Mm01_00077704 predicted 1140
8 SASI_Mm01_00077705 predicted 431
9 SASI_Mm01_00077706 predicted 772
10 SASI_Mm01_00077707 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146102
AFAP1L2 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146102.1-2026s21c1
Sequence:CCGGTGACCAGTGCAGAGATCAAACCTCGAGGTTTGATCTCTGCACTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2944s21c1
Sequence:CCGATGGCAATGTTGAGGTTTAAATCTCGAGATTTAAACCTCAACATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2551s21c1
Sequence:CCGGGAATTGCCTAAAGACTCTTATCTCGAGATAAGAGTCTTTAGGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2684s21c1
Sequence:CCGGGCAAACGGAGCTTCGGTTAAGCTCGAGCTTAACCGAAGCTCCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146102.1-2922s1c1
Sequence:CCGGCCCTTATCTTTCATCCTGTATCTCGAGATACAGGATGAAAGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-2177s1c1
Sequence:CCGGCCTGTTGAGATGCACAGATAACTCGAGTTATCTGTGCATCTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-779s1c1
Sequence:CCGGGCTCAAGATCACACCGATGAACTCGAGTTCATCGGTGTGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-449s1c1
Sequence:CCGGGCCATTTGACAGATCCATCAACTCGAGTTGATGGATCTGTCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-1295s1c1
Sequence:CCGGCCACCTGTATTCCTTCCGTATCTCGAGATACGGAAGGAATACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146102
AFAP1L2 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146102.1-2026s21c1
Sequence:CCGGTGACCAGTGCAGAGATCAAACCTCGAGGTTTGATCTCTGCACTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2944s21c1
Sequence:CCGATGGCAATGTTGAGGTTTAAATCTCGAGATTTAAACCTCAACATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2551s21c1
Sequence:CCGGGAATTGCCTAAAGACTCTTATCTCGAGATAAGAGTCTTTAGGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2684s21c1
Sequence:CCGGGCAAACGGAGCTTCGGTTAAGCTCGAGCTTAACCGAAGCTCCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146102.1-2922s1c1
Sequence:CCGGCCCTTATCTTTCATCCTGTATCTCGAGATACAGGATGAAAGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-2177s1c1
Sequence:CCGGCCTGTTGAGATGCACAGATAACTCGAGTTATCTGTGCATCTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-779s1c1
Sequence:CCGGGCTCAAGATCACACCGATGAACTCGAGTTCATCGGTGTGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-449s1c1
Sequence:CCGGGCCATTTGACAGATCCATCAACTCGAGTTGATGGATCTGTCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-1295s1c1
Sequence:CCGGCCACCTGTATTCCTTCCGTATCTCGAGATACGGAAGGAATACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146102
AFAP1L2 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146102.1-2026s21c1
Sequence:CCGGTGACCAGTGCAGAGATCAAACCTCGAGGTTTGATCTCTGCACTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2944s21c1
Sequence:CCGATGGCAATGTTGAGGTTTAAATCTCGAGATTTAAACCTCAACATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2551s21c1
Sequence:CCGGGAATTGCCTAAAGACTCTTATCTCGAGATAAGAGTCTTTAGGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146102.1-2684s21c1
Sequence:CCGGGCAAACGGAGCTTCGGTTAAGCTCGAGCTTAACCGAAGCTCCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146102.1-2922s1c1
Sequence:CCGGCCCTTATCTTTCATCCTGTATCTCGAGATACAGGATGAAAGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-2177s1c1
Sequence:CCGGCCTGTTGAGATGCACAGATAACTCGAGTTATCTGTGCATCTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-779s1c1
Sequence:CCGGGCTCAAGATCACACCGATGAACTCGAGTTCATCGGTGTGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-449s1c1
Sequence:CCGGGCCATTTGACAGATCCATCAACTCGAGTTGATGGATCTGTCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146102.1-1295s1c1
Sequence:CCGGCCACCTGTATTCCTTCCGTATCTCGAGATACGGAAGGAATACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032550
VALIDATED
AFAP1L2 MISSION shRNA Bacterial Glycerol Stock
actin filament associated protein 1-like 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-2371s21c1
Sequence:CCGGGAAAGAGAAACGGGAGCTAAACTCGAGTTTAGCTCCCGTTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1203s21c1
Sequence:CCGGACCTGTCGGCTTCAGAGTATGCTCGAGCATACTCTGAAGCCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-654s21c1
Sequence:CCGGAGTCTCCAGAGGGCTACTATGCTCGAGCATAGTAGCCCTCTGGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1254s21c1
Sequence:CCGGCAGAAACCAAAGACGTCAAGACTCGAGTCTTGACGTCTTTGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-450s21c1
Sequence:CCGGCTGATGAGGAGTACATTTATACTCGAGTATAAATGTACTCCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1291s21c1
Sequence:CCGGCCTCAAACTGAGCAACCTAATCTCGAGATTAGGTTGCTCAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032550.2-2824s21c1
Sequence:CCGGGCGAAAGGGTGAGTCTGTTTACTCGAGTAAACAGACTCACCCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1685s21c1
Sequence:CCGGGCCGATAGGGTCTCCTGTATTCTCGAGAATACAGGAGACCCTATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-985s21c1
Sequence:CCGGGGAGAAGCAAGTGCGGAAGAACTCGAGTTCTTCCGCACTTGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1173s21c1
Sequence:CCGGACTGCCAGAAACCAGATATAGCTCGAGCTATATCTGGTTTCTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032550.2-2950s21c1
Sequence:CCGGCTTTGGAGACCTAAGTCTATTCTCGAGAATAGACTTAGGTCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-903s21c1
Sequence:CCGGACAGGCTTCTGTGCTACAAATCTCGAGATTTGTAGCACAGAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032550.1-1877s1c1
Sequence:CCGGGATGACCCAAATGAGAGAGAACTCGAGTTCTCTCTCATTTGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032550.1-355s1c1
Sequence:CCGGCAAGATTCTTGACCAGGAGAACTCGAGTTCTCCTGGTCAAGAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032550.1-1363s1c1
Sequence:CCGGCGAGACATCCAGTTACCTGAACTCGAGTTCAGGTAACTGGATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032550.1-1028s1c1
Sequence:CCGGCCGATGAATGCCGATGTGATTCTCGAGAATCACATCGGCATTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032550
VALIDATED
AFAP1L2 MISSION shRNA shRNA Plasmid DNA
actin filament associated protein 1-like 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-2371s21c1
Sequence:CCGGGAAAGAGAAACGGGAGCTAAACTCGAGTTTAGCTCCCGTTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1203s21c1
Sequence:CCGGACCTGTCGGCTTCAGAGTATGCTCGAGCATACTCTGAAGCCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-654s21c1
Sequence:CCGGAGTCTCCAGAGGGCTACTATGCTCGAGCATAGTAGCCCTCTGGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1254s21c1
Sequence:CCGGCAGAAACCAAAGACGTCAAGACTCGAGTCTTGACGTCTTTGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-450s21c1
Sequence:CCGGCTGATGAGGAGTACATTTATACTCGAGTATAAATGTACTCCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1291s21c1
Sequence:CCGGCCTCAAACTGAGCAACCTAATCTCGAGATTAGGTTGCTCAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032550.2-2824s21c1
Sequence:CCGGGCGAAAGGGTGAGTCTGTTTACTCGAGTAAACAGACTCACCCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1685s21c1
Sequence:CCGGGCCGATAGGGTCTCCTGTATTCTCGAGAATACAGGAGACCCTATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-985s21c1
Sequence:CCGGGGAGAAGCAAGTGCGGAAGAACTCGAGTTCTTCCGCACTTGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1173s21c1
Sequence:CCGGACTGCCAGAAACCAGATATAGCTCGAGCTATATCTGGTTTCTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032550.2-2950s21c1
Sequence:CCGGCTTTGGAGACCTAAGTCTATTCTCGAGAATAGACTTAGGTCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-903s21c1
Sequence:CCGGACAGGCTTCTGTGCTACAAATCTCGAGATTTGTAGCACAGAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032550.1-1877s1c1
Sequence:CCGGGATGACCCAAATGAGAGAGAACTCGAGTTCTCTCTCATTTGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032550.1-355s1c1
Sequence:CCGGCAAGATTCTTGACCAGGAGAACTCGAGTTCTCCTGGTCAAGAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032550.1-1363s1c1
Sequence:CCGGCGAGACATCCAGTTACCTGAACTCGAGTTCAGGTAACTGGATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032550.1-1028s1c1
Sequence:CCGGCCGATGAATGCCGATGTGATTCTCGAGAATCACATCGGCATTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032550
VALIDATED
AFAP1L2 MISSION shRNA Lentiviral Transduction Particles
actin filament associated protein 1-like 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-2371s21c1
Sequence:CCGGGAAAGAGAAACGGGAGCTAAACTCGAGTTTAGCTCCCGTTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1203s21c1
Sequence:CCGGACCTGTCGGCTTCAGAGTATGCTCGAGCATACTCTGAAGCCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-654s21c1
Sequence:CCGGAGTCTCCAGAGGGCTACTATGCTCGAGCATAGTAGCCCTCTGGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1254s21c1
Sequence:CCGGCAGAAACCAAAGACGTCAAGACTCGAGTCTTGACGTCTTTGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-450s21c1
Sequence:CCGGCTGATGAGGAGTACATTTATACTCGAGTATAAATGTACTCCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1291s21c1
Sequence:CCGGCCTCAAACTGAGCAACCTAATCTCGAGATTAGGTTGCTCAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032550.2-2824s21c1
Sequence:CCGGGCGAAAGGGTGAGTCTGTTTACTCGAGTAAACAGACTCACCCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1685s21c1
Sequence:CCGGGCCGATAGGGTCTCCTGTATTCTCGAGAATACAGGAGACCCTATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-985s21c1
Sequence:CCGGGGAGAAGCAAGTGCGGAAGAACTCGAGTTCTTCCGCACTTGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-1173s21c1
Sequence:CCGGACTGCCAGAAACCAGATATAGCTCGAGCTATATCTGGTTTCTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032550.2-2950s21c1
Sequence:CCGGCTTTGGAGACCTAAGTCTATTCTCGAGAATAGACTTAGGTCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032550.2-903s21c1
Sequence:CCGGACAGGCTTCTGTGCTACAAATCTCGAGATTTGTAGCACAGAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032550.1-1877s1c1
Sequence:CCGGGATGACCCAAATGAGAGAGAACTCGAGTTCTCTCTCATTTGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032550.1-355s1c1
Sequence:CCGGCAAGATTCTTGACCAGGAGAACTCGAGTTCTCCTGGTCAAGAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032550.1-1363s1c1
Sequence:CCGGCGAGACATCCAGTTACCTGAACTCGAGTTCAGGTAACTGGATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032550.1-1028s1c1
Sequence:CCGGCCGATGAATGCCGATGTGATTCTCGAGAATCACATCGGCATTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks