EMAIL THIS PAGE TO A FRIEND

AFF1

AF4/FMR2 family, member 1

Synonyms: AF4 MLLT2 PBM1
UniProtKB ID: P51825, B4DTU1, E9PBM3
Gene ID:
Mouse(17355) AF4/FMR2 family, member 1
Rat(305152) AF4/FMR2 family, member 1
chicken(422590) AF4/FMR2 family, member 1
domestic cat(101099959) AF4/FMR2 family, member 1
cow(781149) AF4/FMR2 family, member 1
dog(100683405) AF4/FMR2 family, member 1
Domestic Rabbit(100352431) AF4/FMR2 family, member 1
domestic guinea pig(100716638) AF4/FMR2 family, member 1
naked mole-rat(101719249) AF4/FMR2 family, member 1
228 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005935 Rosetta Predictions human pricing
NM_001107206 Rosetta Predictions rat pricing
NM_001080798 Rosetta Predictions mouse pricing
NM_133919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340593 predicted 794
2 SASI_Hs01_00128341 predicted 1508
3 SASI_Hs01_00128342 predicted 3285
4 SASI_Hs01_00128343 predicted 988
5 SASI_Hs01_00128344 predicted 3202
6 SASI_Hs01_00128346 predicted 577
7 SASI_Hs01_00128347 predicted 3454
8 SASI_Hs01_00128348 predicted 1347
9 SASI_Hs01_00128349 predicted 1411
10 SASI_Hs01_00128350 predicted 1520
11 SASI_Hs01_00128345 predicted 3935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226555 predicted 497
2 SASI_Rn02_00226556 predicted 2878
3 SASI_Rn02_00226557 predicted 1509
4 SASI_Rn02_00226558 predicted 2635
5 SASI_Rn02_00226559 predicted 1303
6 SASI_Rn02_00226560 predicted 1324
7 SASI_Rn02_00226561 predicted 651
8 SASI_Rn02_00226562 predicted 2809
9 SASI_Rn02_00226563 predicted 625
10 SASI_Rn02_00226564 predicted 3243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293813 predicted 3405
2 SASI_Mm02_00293814 predicted 3020
3 SASI_Mm02_00293815 predicted 3233
4 SASI_Mm02_00293816 predicted 416
5 SASI_Mm02_00293817 predicted 3243
6 SASI_Mm02_00293818 predicted 544
7 SASI_Mm02_00293819 predicted 3891
8 SASI_Mm02_00293820 predicted 1318
9 SASI_Mm02_00293821 predicted 3803
10 SASI_Mm02_00293822 predicted 2367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063015 predicted 3418
2 SASI_Mm01_00063016 predicted 3033
3 SASI_Mm01_00063017 predicted 3248
4 SASI_Mm01_00063018 predicted 435
5 SASI_Mm01_00063019 predicted 3251
6 SASI_Mm01_00063020 predicted 558
7 SASI_Mm01_00063021 predicted 3904
8 SASI_Mm01_00063022 predicted 1334
9 SASI_Mm01_00063023 predicted 3819
10 SASI_Mm01_00063024 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133919
VALIDATED
AFF1 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133919.2-3778s1c1
Sequence:CCGGCGGGATGCTTGTCCACTTAAACTCGAGTTTAAGTGGACAAGCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-1000s1c1
Sequence:CCGGCCGTACTCCAATGAAGTCCATCTCGAGATGGACTTCATTGGAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-1001s1c1
Sequence:CCGGCGTACTCCAATGAAGTCCATTCTCGAGAATGGACTTCATTGGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-2844s1c1
Sequence:CCGGGCCTTCTTTGCCGAATGGTAACTCGAGTTACCATTCGGCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-3196s1c1
Sequence:CCGGGCGATGTTTCGATGTAAGAAACTCGAGTTTCTTACATCGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-853s21c1
Sequence:CCGGTGGCGAAGGCCCAAGATAAAGCTCGAGCTTTATCTTGGGCCTTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3363s21c1
Sequence:CCGGATGGCGATGTTTCGATGTAAGCTCGAGCTTACATCGAAACATCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3640s21c1
Sequence:CCGGCCCATGTCCTTACGGCCTTTACTCGAGTAAAGGCCGTAAGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-535s21c1
Sequence:CCGGCACGTCCTGTCGGTAACATTACTCGAGTAATGTTACCGACAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-4373s21c1
Sequence:CCGGGATGACAGAGTACTGATATTTCTCGAGAAATATCAGTACTCTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3021s21c1
Sequence:CCGGTTGCCGAATGGTAACGCTAAACTCGAGTTTAGCGTTACCATTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-2408s21c1
Sequence:CCGGGCCTTTGAGAGACACCAAATTCTCGAGAATTTGGTGTCTCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-798s21c1
Sequence:CCGGAGCAGTGGCGTTAGCAGTAAACTCGAGTTTACTGCTAACGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133919
VALIDATED
AFF1 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133919.2-3778s1c1
Sequence:CCGGCGGGATGCTTGTCCACTTAAACTCGAGTTTAAGTGGACAAGCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-1000s1c1
Sequence:CCGGCCGTACTCCAATGAAGTCCATCTCGAGATGGACTTCATTGGAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-1001s1c1
Sequence:CCGGCGTACTCCAATGAAGTCCATTCTCGAGAATGGACTTCATTGGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-2844s1c1
Sequence:CCGGGCCTTCTTTGCCGAATGGTAACTCGAGTTACCATTCGGCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-3196s1c1
Sequence:CCGGGCGATGTTTCGATGTAAGAAACTCGAGTTTCTTACATCGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-853s21c1
Sequence:CCGGTGGCGAAGGCCCAAGATAAAGCTCGAGCTTTATCTTGGGCCTTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3363s21c1
Sequence:CCGGATGGCGATGTTTCGATGTAAGCTCGAGCTTACATCGAAACATCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3640s21c1
Sequence:CCGGCCCATGTCCTTACGGCCTTTACTCGAGTAAAGGCCGTAAGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-535s21c1
Sequence:CCGGCACGTCCTGTCGGTAACATTACTCGAGTAATGTTACCGACAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-4373s21c1
Sequence:CCGGGATGACAGAGTACTGATATTTCTCGAGAAATATCAGTACTCTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3021s21c1
Sequence:CCGGTTGCCGAATGGTAACGCTAAACTCGAGTTTAGCGTTACCATTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-2408s21c1
Sequence:CCGGGCCTTTGAGAGACACCAAATTCTCGAGAATTTGGTGTCTCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-798s21c1
Sequence:CCGGAGCAGTGGCGTTAGCAGTAAACTCGAGTTTACTGCTAACGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133919
VALIDATED
AFF1 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133919.2-3778s1c1
Sequence:CCGGCGGGATGCTTGTCCACTTAAACTCGAGTTTAAGTGGACAAGCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-1000s1c1
Sequence:CCGGCCGTACTCCAATGAAGTCCATCTCGAGATGGACTTCATTGGAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-1001s1c1
Sequence:CCGGCGTACTCCAATGAAGTCCATTCTCGAGAATGGACTTCATTGGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-2844s1c1
Sequence:CCGGGCCTTCTTTGCCGAATGGTAACTCGAGTTACCATTCGGCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133919.2-3196s1c1
Sequence:CCGGGCGATGTTTCGATGTAAGAAACTCGAGTTTCTTACATCGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-853s21c1
Sequence:CCGGTGGCGAAGGCCCAAGATAAAGCTCGAGCTTTATCTTGGGCCTTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3363s21c1
Sequence:CCGGATGGCGATGTTTCGATGTAAGCTCGAGCTTACATCGAAACATCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3640s21c1
Sequence:CCGGCCCATGTCCTTACGGCCTTTACTCGAGTAAAGGCCGTAAGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-535s21c1
Sequence:CCGGCACGTCCTGTCGGTAACATTACTCGAGTAATGTTACCGACAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-4373s21c1
Sequence:CCGGGATGACAGAGTACTGATATTTCTCGAGAAATATCAGTACTCTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133919.3-3021s21c1
Sequence:CCGGTTGCCGAATGGTAACGCTAAACTCGAGTTTAGCGTTACCATTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-2408s21c1
Sequence:CCGGGCCTTTGAGAGACACCAAATTCTCGAGAATTTGGTGTCTCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133919.3-798s21c1
Sequence:CCGGAGCAGTGGCGTTAGCAGTAAACTCGAGTTTACTGCTAACGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005935
VALIDATED
AFF1 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-787s1c1
Sequence:CCGGCCACTTTCTGTTGGCAACATTCTCGAGAATGTTGCCAACAGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-1525s1c1
Sequence:CCGGCCTCCTTTGACAGCAATACATCTCGAGATGTATTGCTGTCAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-2945s1c1
Sequence:CCGGCCTCCCACAAAGAATCTTCTACTCGAGTAGAAGATTCTTTGTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005935.1-3999s1c1
Sequence:CCGGGCACTATACACGACAGGGTTTCTCGAGAAACCCTGTCGTGTATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005935.1-3282s1c1
Sequence:CCGGGCCTCAAGTGAAGTTTGACAACTCGAGTTGTCAAACTTCACTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-3269s21c1
Sequence:CCGGGCCTCAAGTGAAGTTTGACAACTCGAGTTGTCAAACTTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-2932s21c1
Sequence:CCGGCCTCCCACAAAGAATCTTCTACTCGAGTAGAAGATTCTTTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-662s21c1
Sequence:CCGGTAGGTTGGGAAAGCCGAAATACTCGAGTATTTCGGCTTTCCCAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-1512s21c1
Sequence:CCGGCCTCCTTTGACAGCAATACATCTCGAGATGTATTGCTGTCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005935
VALIDATED
AFF1 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-787s1c1
Sequence:CCGGCCACTTTCTGTTGGCAACATTCTCGAGAATGTTGCCAACAGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-1525s1c1
Sequence:CCGGCCTCCTTTGACAGCAATACATCTCGAGATGTATTGCTGTCAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-2945s1c1
Sequence:CCGGCCTCCCACAAAGAATCTTCTACTCGAGTAGAAGATTCTTTGTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005935.1-3999s1c1
Sequence:CCGGGCACTATACACGACAGGGTTTCTCGAGAAACCCTGTCGTGTATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005935.1-3282s1c1
Sequence:CCGGGCCTCAAGTGAAGTTTGACAACTCGAGTTGTCAAACTTCACTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-3269s21c1
Sequence:CCGGGCCTCAAGTGAAGTTTGACAACTCGAGTTGTCAAACTTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-2932s21c1
Sequence:CCGGCCTCCCACAAAGAATCTTCTACTCGAGTAGAAGATTCTTTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-662s21c1
Sequence:CCGGTAGGTTGGGAAAGCCGAAATACTCGAGTATTTCGGCTTTCCCAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-1512s21c1
Sequence:CCGGCCTCCTTTGACAGCAATACATCTCGAGATGTATTGCTGTCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005935
VALIDATED
AFF1 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-787s1c1
Sequence:CCGGCCACTTTCTGTTGGCAACATTCTCGAGAATGTTGCCAACAGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-1525s1c1
Sequence:CCGGCCTCCTTTGACAGCAATACATCTCGAGATGTATTGCTGTCAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005935.1-2945s1c1
Sequence:CCGGCCTCCCACAAAGAATCTTCTACTCGAGTAGAAGATTCTTTGTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005935.1-3999s1c1
Sequence:CCGGGCACTATACACGACAGGGTTTCTCGAGAAACCCTGTCGTGTATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005935.1-3282s1c1
Sequence:CCGGGCCTCAAGTGAAGTTTGACAACTCGAGTTGTCAAACTTCACTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-3269s21c1
Sequence:CCGGGCCTCAAGTGAAGTTTGACAACTCGAGTTGTCAAACTTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-2932s21c1
Sequence:CCGGCCTCCCACAAAGAATCTTCTACTCGAGTAGAAGATTCTTTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-662s21c1
Sequence:CCGGTAGGTTGGGAAAGCCGAAATACTCGAGTATTTCGGCTTTCCCAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005935.2-1512s21c1
Sequence:CCGGCCTCCTTTGACAGCAATACATCTCGAGATGTATTGCTGTCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks