EMAIL THIS PAGE TO A FRIEND

AFF2

AF4/FMR2 family, member 2

371 Gene Product Result for
Synonyms: FMR2 FMR2P FRAXE MRX2 OX19
Gene ID:
Human(2334) Summary: This gene encodes a putative transcriptional activator that is a member of the AF4\FMR2 gene family. This gene is associated with the folate-sensitive fragile X E locus on chromosome X. A repeat polymorphism in the fragile X E locus results in silencing of this gene causing Fragile X E syndrome. Fragile X E syndrome is a form of nonsyndromic X-linked mental retardation. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2009]
Mouse(14266) AF4/FMR2 family, member 2
Rat(293922) AF4/FMR2 family, member 2
naked mole-rat(101710218) AF4/FMR2 family, member 2
domestic guinea pig(100717526) AF4/FMR2 family, member 2
sheep(101116804) AF4/FMR2 family, member 2
Domestic Rabbit(100356143) AF4/FMR2 family, member 2
chicken(422394) AF4/FMR2 family, member 2
cow(522215) AF4/FMR2 family, member 2
Horse(100055437) AF4/FMR2 family, member 2
dog(492193) AF4/FMR2 family, member 2
domestic cat(101092251) AF4/FMR2 family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002025 Rosetta Predictions human pricing
XM_001054673 Rosetta Predictions rat pricing
XM_219832 Rosetta Predictions rat pricing
NM_008032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181792 predicted 2791
2 SASI_Hs01_00181793 predicted 4003
3 SASI_Hs01_00181794 predicted 965
4 SASI_Hs01_00181795 predicted 3947
5 SASI_Hs01_00181796 predicted 1007
6 SASI_Hs01_00181797 predicted 1523
7 SASI_Hs02_00333043 predicted 2339
8 SASI_Hs01_00181799 predicted 2706
9 SASI_Hs01_00181800 predicted 2400
10 SASI_Hs02_00333044 predicted 2609
11 SASI_Hs01_00181798 predicted 3976
12 SASI_Hs01_00181801 predicted 2307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276777 predicted 2565
2 SASI_Rn02_00276778 predicted 3908
3 SASI_Rn02_00276779 predicted 3925
4 SASI_Rn02_00276780 predicted 2862
5 SASI_Rn02_00276781 predicted 891
6 SASI_Rn02_00276782 predicted 1378
7 SASI_Rn02_00276783 predicted 629
8 SASI_Rn02_00276784 predicted 862
9 SASI_Rn02_00276785 predicted 4241
10 SASI_Rn02_00276786 predicted 2875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378749 predicted 2571
2 SASI_Rn02_00378750 predicted 3907
3 SASI_Rn02_00378751 predicted 3922
4 SASI_Rn02_00378752 predicted 2866
5 SASI_Rn02_00378753 predicted 889
6 SASI_Rn02_00378754 predicted 1377
7 SASI_Rn02_00378755 predicted 862
8 SASI_Rn02_00378756 predicted 4246
9 SASI_Rn02_00378757 predicted 2878
10 SASI_Rn02_00378758 predicted 2212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069642 predicted 2826
2 SASI_Mm01_00069643 predicted 3867
3 SASI_Mm01_00069645 predicted 612
4 SASI_Mm01_00069646 predicted 834
5 SASI_Mm02_00312988 predicted 2118
6 SASI_Mm01_00069649 predicted 4211
7 SASI_Mm02_00312989 predicted 3570
8 SASI_Mm01_00069650 predicted 4056
9 SASI_Mm01_00069651 predicted 2748
10 SASI_Mm02_00312990 predicted 3167
11 SASI_Mm01_00069644 predicted 1379
12 SASI_Mm01_00069647 predicted 2127
13 SASI_Mm01_00069648 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002025
AFF2 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3737s21c1
Sequence:CCGGTGATGCACTGTTCGAGAAATTCTCGAGAATTTCTCGAACAGTGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3682s21c1
Sequence:CCGGCGGTTCACAATGCTGATTATTCTCGAGAATAATCAGCATTGTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002025.2-5939s21c1
Sequence:CCGGTAATTACCTGCTGGTATATAACTCGAGTTATATACCAGCAGGTAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3948s21c1
Sequence:GTACCGGGTACTATGCTACCGATGTTTACTCGAGTAAACATCGGTAGCATAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-1989s21c1
Sequence:CCGGACCACTGACAGCGAATCTAATCTCGAGATTAGATTCGCTGTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002025.1-5969s1c1
Sequence:CCGGGCCTTTAATATGCTGGGTTATCTCGAGATAACCCAGCATATTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-3959s1c1
Sequence:CCGGCCGATGTTTATCACTCCTCTACTCGAGTAGAGGAGTGATAAACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-1010s1c1
Sequence:CCGGGCCAAACAAGATGCAGACTTTCTCGAGAAAGTCTGCATCTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-4266s1c1
Sequence:CCGGGCCGACAAACTGACAAGAGAACTCGAGTTCTCTTGTCAGTTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-3960s1c1
Sequence:CCGGCGATGTTTATCACTCCTCTATCTCGAGATAGAGGAGTGATAAACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002025
AFF2 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3737s21c1
Sequence:CCGGTGATGCACTGTTCGAGAAATTCTCGAGAATTTCTCGAACAGTGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3682s21c1
Sequence:CCGGCGGTTCACAATGCTGATTATTCTCGAGAATAATCAGCATTGTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002025.2-5939s21c1
Sequence:CCGGTAATTACCTGCTGGTATATAACTCGAGTTATATACCAGCAGGTAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3948s21c1
Sequence:GTACCGGGTACTATGCTACCGATGTTTACTCGAGTAAACATCGGTAGCATAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-1989s21c1
Sequence:CCGGACCACTGACAGCGAATCTAATCTCGAGATTAGATTCGCTGTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002025.1-5969s1c1
Sequence:CCGGGCCTTTAATATGCTGGGTTATCTCGAGATAACCCAGCATATTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-3959s1c1
Sequence:CCGGCCGATGTTTATCACTCCTCTACTCGAGTAGAGGAGTGATAAACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-1010s1c1
Sequence:CCGGGCCAAACAAGATGCAGACTTTCTCGAGAAAGTCTGCATCTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-4266s1c1
Sequence:CCGGGCCGACAAACTGACAAGAGAACTCGAGTTCTCTTGTCAGTTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-3960s1c1
Sequence:CCGGCGATGTTTATCACTCCTCTATCTCGAGATAGAGGAGTGATAAACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002025
AFF2 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3737s21c1
Sequence:CCGGTGATGCACTGTTCGAGAAATTCTCGAGAATTTCTCGAACAGTGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3682s21c1
Sequence:CCGGCGGTTCACAATGCTGATTATTCTCGAGAATAATCAGCATTGTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002025.2-5939s21c1
Sequence:CCGGTAATTACCTGCTGGTATATAACTCGAGTTATATACCAGCAGGTAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-3948s21c1
Sequence:GTACCGGGTACTATGCTACCGATGTTTACTCGAGTAAACATCGGTAGCATAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002025.2-1989s21c1
Sequence:CCGGACCACTGACAGCGAATCTAATCTCGAGATTAGATTCGCTGTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002025.1-5969s1c1
Sequence:CCGGGCCTTTAATATGCTGGGTTATCTCGAGATAACCCAGCATATTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-3959s1c1
Sequence:CCGGCCGATGTTTATCACTCCTCTACTCGAGTAGAGGAGTGATAAACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-1010s1c1
Sequence:CCGGGCCAAACAAGATGCAGACTTTCTCGAGAAAGTCTGCATCTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-4266s1c1
Sequence:CCGGGCCGACAAACTGACAAGAGAACTCGAGTTCTCTTGTCAGTTTGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002025.1-3960s1c1
Sequence:CCGGCGATGTTTATCACTCCTCTATCTCGAGATAGAGGAGTGATAAACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008032
AFF2 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-625s1c1
Sequence:CCGGCCCTACAAGGTAGCTGAATATCTCGAGATATTCAGCTACCTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-2560s1c1
Sequence:CCGGCCACCTTGCATTACTTCTAAACTCGAGTTTAGAAGTAATGCAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-1076s1c1
Sequence:CCGGCCCAAATTGGTACAGTTGAAACTCGAGTTTCAACTGTACCAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-2559s1c1
Sequence:CCGGGCCACCTTGCATTACTTCTAACTCGAGTTAGAAGTAATGCAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008032.1-4314s1c1
Sequence:CCGGCTCATCCTTTACCAGTGCCTTCTCGAGAAGGCACTGGTAAAGGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008032
AFF2 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-625s1c1
Sequence:CCGGCCCTACAAGGTAGCTGAATATCTCGAGATATTCAGCTACCTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-2560s1c1
Sequence:CCGGCCACCTTGCATTACTTCTAAACTCGAGTTTAGAAGTAATGCAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-1076s1c1
Sequence:CCGGCCCAAATTGGTACAGTTGAAACTCGAGTTTCAACTGTACCAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-2559s1c1
Sequence:CCGGGCCACCTTGCATTACTTCTAACTCGAGTTAGAAGTAATGCAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008032.1-4314s1c1
Sequence:CCGGCTCATCCTTTACCAGTGCCTTCTCGAGAAGGCACTGGTAAAGGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008032
AFF2 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-625s1c1
Sequence:CCGGCCCTACAAGGTAGCTGAATATCTCGAGATATTCAGCTACCTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-2560s1c1
Sequence:CCGGCCACCTTGCATTACTTCTAAACTCGAGTTTAGAAGTAATGCAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-1076s1c1
Sequence:CCGGCCCAAATTGGTACAGTTGAAACTCGAGTTTCAACTGTACCAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008032.1-2559s1c1
Sequence:CCGGGCCACCTTGCATTACTTCTAACTCGAGTTAGAAGTAATGCAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008032.1-4314s1c1
Sequence:CCGGCTCATCCTTTACCAGTGCCTTCTCGAGAAGGCACTGGTAAAGGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)