EMAIL THIS PAGE TO A FRIEND

AFF3

AF4/FMR2 family, member 3

211 Gene Product Result for
Synonyms: LAF4 MLLT2-like
Gene ID:
Human(3899) Summary: This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16764) AF4/FMR2 family, member 3
Rat(363220) AF4/FMR2 family, member 3
Zebrafish(570215) AF4/FMR2 family, member 3
chicken(418705) AF4/FMR2 family, member 3
cow(787488) AF4/FMR2 family, member 3
Horse(100059904) AF4/FMR2 family, member 3
domestic cat(101095569) AF4/FMR2 family, member 3
dog(611584) AF4/FMR2 family, member 3
sheep(101111623) AF4/FMR2 family, member 3
Domestic Rabbit(100347557) AF4/FMR2 family, member 3
domestic guinea pig(100719882) AF4/FMR2 family, member 3
naked mole-rat(101701232) AF4/FMR2 family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_283603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025108 Rosetta Predictions human pricing
NM_002285 Rosetta Predictions human pricing
XM_001058147 Rosetta Predictions rat pricing
XM_343559 Rosetta Predictions rat pricing
NM_010678 Rosetta Predictions mouse pricing
XM_001477293 Rosetta Predictions mouse pricing
XM_001478017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212221 predicted 2731
2 SASI_Hs01_00212223 predicted 3318
3 SASI_Hs01_00212224 predicted 3927
4 SASI_Hs02_00307374 predicted 2760
5 SASI_Hs01_00212225 predicted 2800
6 SASI_Hs01_00212226 predicted 3168
7 SASI_Hs01_00212227 predicted 479
8 SASI_Hs01_00212228 predicted 526
9 SASI_Hs02_00307375 predicted 3229
10 SASI_Hs01_00212229 predicted 1695
11 SASI_Hs01_00212222 predicted 3395
12 SASI_Hs01_00212230 predicted 2922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118198 predicted 2747
2 SASI_Hs01_00118200 predicted 3330
3 SASI_Hs01_00118201 predicted 3945
4 SASI_Hs02_00333572 predicted 2784
5 SASI_Hs01_00118202 predicted 2812
6 SASI_Hs01_00118203 predicted 3182
7 SASI_Hs01_00118204 predicted 493
8 SASI_Hs01_00118205 predicted 544
9 SASI_Hs02_00333573 predicted 3250
10 SASI_Hs01_00118206 predicted 1714
11 SASI_Hs01_00118199 predicted 3406
12 SASI_Hs01_00118207 predicted 2945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288755 predicted 2627
2 SASI_Rn02_00288756 predicted 1049
3 SASI_Rn02_00288757 predicted 223
4 SASI_Rn02_00288758 predicted 1078
5 SASI_Rn02_00288759 predicted 255
6 SASI_Rn02_00288760 predicted 1019
7 SASI_Rn02_00288761 predicted 2529
8 SASI_Rn02_00288762 predicted 3252
9 SASI_Rn02_00288763 predicted 2836
10 SASI_Rn02_00288764 predicted 2065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396028 predicted 2625
2 SASI_Rn02_00396029 predicted 1045
3 SASI_Rn02_00396030 predicted 226
4 SASI_Rn02_00396031 predicted 1075
5 SASI_Rn02_00396032 predicted 287
6 SASI_Rn02_00396033 predicted 252
7 SASI_Rn02_00396034 predicted 1015
8 SASI_Rn02_00396035 predicted 3255
9 SASI_Rn02_00396036 predicted 2833
10 SASI_Rn02_00396037 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319110 predicted 1697
2 SASI_Mm02_00319111 predicted 3473
3 SASI_Mm01_00090521 predicted 3255
4 SASI_Mm02_00319112 predicted 943
5 SASI_Mm02_00319113 predicted 3312
6 SASI_Mm02_00319114 predicted 2679
7 SASI_Mm01_00090524 predicted 379
8 SASI_Mm02_00319115 predicted 1144
9 SASI_Mm01_00090525 predicted 1180
10 SASI_Mm01_00090526 predicted 404
11 SASI_Mm01_00090519 predicted 2614
12 SASI_Mm01_00090520 predicted 655
13 SASI_Mm01_00090522 predicted 2556
14 SASI_Mm01_00090523 predicted 2341
15 SASI_Mm01_00090527 predicted 2397
16 SASI_Mm01_00090528 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00394848 predicted 1704
2 SASI_Mm02_00394849 predicted 3377
3 SASI_Mm02_00394850 predicted 3257
4 SASI_Mm02_00394851 predicted 3100
5 SASI_Mm02_00394852 predicted 381
6 SASI_Mm02_00394853 predicted 3159
7 SASI_Mm02_00394854 predicted 3411
8 SASI_Mm02_00394855 predicted 2686
9 SASI_Mm02_00394856 predicted 931
10 SASI_Mm02_00394857 predicted 3076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399752 predicted 749
2 SASI_Mm02_00399753 predicted 2588
3 SASI_Mm02_00399754 predicted 2792
4 SASI_Mm02_00399755 predicted 1533
5 SASI_Mm02_00399756 predicted 571
6 SASI_Mm02_00399757 predicted 338
7 SASI_Mm02_00399758 predicted 1544
8 SASI_Mm02_00399759 predicted 719
9 SASI_Mm02_00399760 predicted 2815
10 SASI_Mm02_00399761 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283603
AFF3 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283603.2-4792s1c1
Sequence:CCGGGCTGCTTACAATGCAGGGAAACTCGAGTTTCCCTGCATTGTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-2538s1c1
Sequence:CCGGCGAAGATGACTACAGGGAGATCTCGAGATCTCCCTGTAGTCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-1464s1c1
Sequence:CCGGGCTGGATAAATGGCTAAACAACTCGAGTTGTTTAGCCATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-372s1c1
Sequence:CCGGGAACAAGATAGATGAGCATTTCTCGAGAAATGCTCATCTATCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-1461s1c1
Sequence:CCGGGCAGCTGGATAAATGGCTAAACTCGAGTTTAGCCATTTATCCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283603
AFF3 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283603.2-4792s1c1
Sequence:CCGGGCTGCTTACAATGCAGGGAAACTCGAGTTTCCCTGCATTGTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-2538s1c1
Sequence:CCGGCGAAGATGACTACAGGGAGATCTCGAGATCTCCCTGTAGTCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-1464s1c1
Sequence:CCGGGCTGGATAAATGGCTAAACAACTCGAGTTGTTTAGCCATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-372s1c1
Sequence:CCGGGAACAAGATAGATGAGCATTTCTCGAGAAATGCTCATCTATCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-1461s1c1
Sequence:CCGGGCAGCTGGATAAATGGCTAAACTCGAGTTTAGCCATTTATCCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283603
AFF3 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283603.2-4792s1c1
Sequence:CCGGGCTGCTTACAATGCAGGGAAACTCGAGTTTCCCTGCATTGTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-2538s1c1
Sequence:CCGGCGAAGATGACTACAGGGAGATCTCGAGATCTCCCTGTAGTCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-1464s1c1
Sequence:CCGGGCTGGATAAATGGCTAAACAACTCGAGTTGTTTAGCCATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-372s1c1
Sequence:CCGGGAACAAGATAGATGAGCATTTCTCGAGAAATGCTCATCTATCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283603.2-1461s1c1
Sequence:CCGGGCAGCTGGATAAATGGCTAAACTCGAGTTTAGCCATTTATCCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002285
AFF3 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-3186s1c1
Sequence:CCGGGCTAAACGAATGAAGCATAAACTCGAGTTTATGCTTCATTCGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-443s1c1
Sequence:CCGGCCAGAACACTTTAGGCAATTACTCGAGTAATTGCCTAAAGTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-3479s1c1
Sequence:CCGGCCACGCTGTAAAGTATTCAAACTCGAGTTTGAATACTTTACAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-1173s1c1
Sequence:CCGGCCACCACTTTCTGCTATTCAACTCGAGTTGAATAGCAGAAAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002285.2-5448s1c1
Sequence:CCGGCGGTGTAATATGTGGTGCAATCTCGAGATTGCACCACATATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-1008s21c1
Sequence:CCGGAGCGTGCACTGCACATCATACCTCGAGGTATGATGTGCAGTGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-358s21c1
Sequence:CCGGAGGATGATGGCACGTTTAATTCTCGAGAATTAAACGTGCCATCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-3251s21c1
Sequence:CCGGTGAAGCAGCATTGTCGTTTATCTCGAGATAAACGACAATGCTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002285
AFF3 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-3186s1c1
Sequence:CCGGGCTAAACGAATGAAGCATAAACTCGAGTTTATGCTTCATTCGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-443s1c1
Sequence:CCGGCCAGAACACTTTAGGCAATTACTCGAGTAATTGCCTAAAGTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-3479s1c1
Sequence:CCGGCCACGCTGTAAAGTATTCAAACTCGAGTTTGAATACTTTACAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-1173s1c1
Sequence:CCGGCCACCACTTTCTGCTATTCAACTCGAGTTGAATAGCAGAAAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002285.2-5448s1c1
Sequence:CCGGCGGTGTAATATGTGGTGCAATCTCGAGATTGCACCACATATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-1008s21c1
Sequence:CCGGAGCGTGCACTGCACATCATACCTCGAGGTATGATGTGCAGTGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-358s21c1
Sequence:CCGGAGGATGATGGCACGTTTAATTCTCGAGAATTAAACGTGCCATCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-3251s21c1
Sequence:CCGGTGAAGCAGCATTGTCGTTTATCTCGAGATAAACGACAATGCTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002285
AFF3 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-3186s1c1
Sequence:CCGGGCTAAACGAATGAAGCATAAACTCGAGTTTATGCTTCATTCGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-443s1c1
Sequence:CCGGCCAGAACACTTTAGGCAATTACTCGAGTAATTGCCTAAAGTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-3479s1c1
Sequence:CCGGCCACGCTGTAAAGTATTCAAACTCGAGTTTGAATACTTTACAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002285.2-1173s1c1
Sequence:CCGGCCACCACTTTCTGCTATTCAACTCGAGTTGAATAGCAGAAAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002285.2-5448s1c1
Sequence:CCGGCGGTGTAATATGTGGTGCAATCTCGAGATTGCACCACATATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-1008s21c1
Sequence:CCGGAGCGTGCACTGCACATCATACCTCGAGGTATGATGTGCAGTGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-358s21c1
Sequence:CCGGAGGATGATGGCACGTTTAATTCTCGAGAATTAAACGTGCCATCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002285.2-3251s21c1
Sequence:CCGGTGAAGCAGCATTGTCGTTTATCTCGAGATAAACGACAATGCTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks