EMAIL THIS PAGE TO A FRIEND

AFF4

AF4/FMR2 family, member 4

310 Gene Product Result for
Synonyms: AF5Q31 MCEF
Gene ID:
Human(27125) Summary: The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
Mouse(93736) AF4/FMR2 family, member 4
Rat(303132) AF4/FMR2 family, member 4
naked mole-rat(101710985) AF4/FMR2 family, member 4
domestic guinea pig(100723342) AF4/FMR2 family, member 4
sheep(101121933) AF4/FMR2 family, member 4
Domestic Rabbit(100328920) AF4/FMR2 family, member 4
Zebrafish(556421) AF4/FMR2 family, member 4
cow(541306) AF4/FMR2 family, member 4
Horse(100063038) AF4/FMR2 family, member 4
domestic cat(101085687) AF4/FMR2 family, member 4
dog(474678) AF4/FMR2 family, member 4
chicken(416337) AF4/FMR2 family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036291 MISSION® esiRNA esiRNA targeting mouse Aff4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014423 Rosetta Predictions human pricing
NM_001107001 Rosetta Predictions rat pricing
NM_033565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169854 predicted 2344
2 SASI_Hs01_00169855 predicted 3829
3 SASI_Hs01_00169856 predicted 3063
4 SASI_Hs01_00169858 predicted 607
5 SASI_Hs01_00169859 predicted 2312
6 SASI_Hs01_00169860 predicted 2898
7 SASI_Hs02_00345620 predicted 2330
8 SASI_Hs02_00345621 predicted 2522
9 SASI_Hs01_00169861 predicted 3109
10 SASI_Hs01_00169862 predicted 534
11 SASI_Hs01_00169853 predicted 3603
12 SASI_Hs01_00169857 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224506 predicted 3555
2 SASI_Rn02_00224507 predicted 3088
3 SASI_Rn02_00224508 predicted 3119
4 SASI_Rn02_00224509 predicted 1529
5 SASI_Rn02_00224510 predicted 1702
6 SASI_Rn02_00224511 predicted 2978
7 SASI_Rn02_00224512 predicted 3105
8 SASI_Rn02_00224513 predicted 906
9 SASI_Rn02_00224514 predicted 2204
10 SASI_Rn02_00224515 predicted 2573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108882 predicted 509
2 SASI_Mm01_00108883 predicted 2450
3 SASI_Mm01_00108884 predicted 2686
4 SASI_Mm01_00108885 predicted 3140
5 SASI_Mm02_00337395 predicted 3124
6 SASI_Mm01_00108886 predicted 316
7 SASI_Mm01_00108887 predicted 2360
8 SASI_Mm01_00108888 predicted 3362
9 SASI_Mm01_00108889 predicted 1649
10 SASI_Mm01_00108890 predicted 425
11 SASI_Mm01_00108891 predicted 2606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014423
VALIDATED
AFF4 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014423.3-4168s21c1
Sequence:CCGGCAGTTGCAATTCATAACTAATCTCGAGATTAGTTATGAATTGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-1954s21c1
Sequence:CCGGACTGATACAAGTGGACCTAAACTCGAGTTTAGGTCCACTTGTATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-3831s21c1
Sequence:CCGGGACAGATCTAGTTCGTTATACCTCGAGGTATAACGAACTAGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-3025s21c1
Sequence:CCGGAGTAGCTCCAAGGAGGTTAAGCTCGAGCTTAACCTCCTTGGAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014423.3-4373s21c1
Sequence:CCGGGTAAGAATTGGTTCGTCTAAACTCGAGTTTAGACGAACCAATTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-2895s21c1
Sequence:CCGGCTCTCGGAAGAGGACTATTAGCTCGAGCTAATAGTCCTCTTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-858s21c1
Sequence:CCGGGCACGACCGTGAGTCATATAACTCGAGTTATATGACTCACGGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014423.1-3080s1c1
Sequence:CCGGGCAGACCATTATTTACAAGAACTCGAGTTCTTGTAAATAATGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014423.1-449s1c1
Sequence:CCGGCCATACAAAGTTACTAGCAAACTCGAGTTTGCTAGTAACTTTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014423.1-1456s1c1
Sequence:CCGGGCACCAGTCTAAATCTATGTTCTCGAGAACATAGATTTAGACTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014423.1-3618s1c1
Sequence:CCGGCCAGCTATGTTCAGGTCACATCTCGAGATGTGACCTGAACATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014423
VALIDATED
AFF4 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014423.3-4168s21c1
Sequence:CCGGCAGTTGCAATTCATAACTAATCTCGAGATTAGTTATGAATTGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-1954s21c1
Sequence:CCGGACTGATACAAGTGGACCTAAACTCGAGTTTAGGTCCACTTGTATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-3831s21c1
Sequence:CCGGGACAGATCTAGTTCGTTATACCTCGAGGTATAACGAACTAGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-3025s21c1
Sequence:CCGGAGTAGCTCCAAGGAGGTTAAGCTCGAGCTTAACCTCCTTGGAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014423.3-4373s21c1
Sequence:CCGGGTAAGAATTGGTTCGTCTAAACTCGAGTTTAGACGAACCAATTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-2895s21c1
Sequence:CCGGCTCTCGGAAGAGGACTATTAGCTCGAGCTAATAGTCCTCTTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-858s21c1
Sequence:CCGGGCACGACCGTGAGTCATATAACTCGAGTTATATGACTCACGGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014423.1-3080s1c1
Sequence:CCGGGCAGACCATTATTTACAAGAACTCGAGTTCTTGTAAATAATGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014423.1-449s1c1
Sequence:CCGGCCATACAAAGTTACTAGCAAACTCGAGTTTGCTAGTAACTTTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014423.1-1456s1c1
Sequence:CCGGGCACCAGTCTAAATCTATGTTCTCGAGAACATAGATTTAGACTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014423.1-3618s1c1
Sequence:CCGGCCAGCTATGTTCAGGTCACATCTCGAGATGTGACCTGAACATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014423
VALIDATED
AFF4 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014423.3-4168s21c1
Sequence:CCGGCAGTTGCAATTCATAACTAATCTCGAGATTAGTTATGAATTGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-1954s21c1
Sequence:CCGGACTGATACAAGTGGACCTAAACTCGAGTTTAGGTCCACTTGTATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-3831s21c1
Sequence:CCGGGACAGATCTAGTTCGTTATACCTCGAGGTATAACGAACTAGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-3025s21c1
Sequence:CCGGAGTAGCTCCAAGGAGGTTAAGCTCGAGCTTAACCTCCTTGGAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014423.3-4373s21c1
Sequence:CCGGGTAAGAATTGGTTCGTCTAAACTCGAGTTTAGACGAACCAATTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-2895s21c1
Sequence:CCGGCTCTCGGAAGAGGACTATTAGCTCGAGCTAATAGTCCTCTTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014423.3-858s21c1
Sequence:CCGGGCACGACCGTGAGTCATATAACTCGAGTTATATGACTCACGGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014423.1-3080s1c1
Sequence:CCGGGCAGACCATTATTTACAAGAACTCGAGTTCTTGTAAATAATGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014423.1-449s1c1
Sequence:CCGGCCATACAAAGTTACTAGCAAACTCGAGTTTGCTAGTAACTTTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014423.1-1456s1c1
Sequence:CCGGGCACCAGTCTAAATCTATGTTCTCGAGAACATAGATTTAGACTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014423.1-3618s1c1
Sequence:CCGGCCAGCTATGTTCAGGTCACATCTCGAGATGTGACCTGAACATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033565
AFF4 MISSION shRNA Bacterial Glycerol Stock
AF4/FMR2 family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033565.1-7858s1c1
Sequence:CCGGGCGGTCACATTTGTAAATGTACTCGAGTACATTTACAAATGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-3019s1c1
Sequence:CCGGGCCTTTGATGACAGAAATTATCTCGAGATAATTTCTGTCATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-987s1c1
Sequence:CCGGGCAACATTCAAGTCAGTCTTTCTCGAGAAAGACTGACTTGAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-2361s1c1
Sequence:CCGGGCAACGAATGTTCTCTCCTATCTCGAGATAGGAGAGAACATTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-421s1c1
Sequence:CCGGCCATACAAAGTCACTAGCAAACTCGAGTTTGCTAGTGACTTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033565
AFF4 MISSION shRNA shRNA Plasmid DNA
AF4/FMR2 family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033565.1-7858s1c1
Sequence:CCGGGCGGTCACATTTGTAAATGTACTCGAGTACATTTACAAATGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-3019s1c1
Sequence:CCGGGCCTTTGATGACAGAAATTATCTCGAGATAATTTCTGTCATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-987s1c1
Sequence:CCGGGCAACATTCAAGTCAGTCTTTCTCGAGAAAGACTGACTTGAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-2361s1c1
Sequence:CCGGGCAACGAATGTTCTCTCCTATCTCGAGATAGGAGAGAACATTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-421s1c1
Sequence:CCGGCCATACAAAGTCACTAGCAAACTCGAGTTTGCTAGTGACTTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033565
AFF4 MISSION shRNA Lentiviral Transduction Particles
AF4/FMR2 family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033565.1-7858s1c1
Sequence:CCGGGCGGTCACATTTGTAAATGTACTCGAGTACATTTACAAATGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-3019s1c1
Sequence:CCGGGCCTTTGATGACAGAAATTATCTCGAGATAATTTCTGTCATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-987s1c1
Sequence:CCGGGCAACATTCAAGTCAGTCTTTCTCGAGAAAGACTGACTTGAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-2361s1c1
Sequence:CCGGGCAACGAATGTTCTCTCCTATCTCGAGATAGGAGAGAACATTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033565.1-421s1c1
Sequence:CCGGCCATACAAAGTCACTAGCAAACTCGAGTTTGCTAGTGACTTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks