EMAIL THIS PAGE TO A FRIEND

AFG3L1P

AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene

114 Gene Product Result for
Synonyms: AFG3 AFG3L1
Species: Human AFG3L1P(172)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031805 Rosetta Predictions human pricing
NM_001132 Rosetta Predictions human pricing
NR_003226 Rosetta Predictions human pricing
NR_003228 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126404 predicted 482
2 SASI_Hs01_00126405 predicted 863
3 SASI_Hs01_00126406 predicted 980
4 SASI_Hs01_00126407 predicted 1210
5 SASI_Hs01_00126408 predicted 764
6 SASI_Hs01_00126409 predicted 1205
7 SASI_Hs01_00126410 predicted 462
8 SASI_Hs01_00126411 predicted 611
9 SASI_Hs01_00126412 predicted 1135
10 SASI_Hs01_00126413 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036306 predicted 433
2 SASI_Hs01_00036307 predicted 1315
3 SASI_Hs01_00036308 predicted 1482
4 SASI_Hs01_00036309 predicted 1439
5 SASI_Hs01_00036310 predicted 900
6 SASI_Hs01_00036311 predicted 828
7 SASI_Hs01_00036312 predicted 571
8 SASI_Hs01_00036313 predicted 639
9 SASI_Hs01_00036314 predicted 991
10 SASI_Hs01_00036315 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378769 predicted 777
2 SASI_Hs02_00378770 predicted 1239
3 SASI_Hs02_00378771 predicted 793
4 SASI_Hs02_00378772 predicted 1246
5 SASI_Hs02_00378773 predicted 825
6 SASI_Hs02_00378774 predicted 1282
7 SASI_Hs02_00378775 predicted 777
8 SASI_Hs02_00378776 predicted 1267
9 SASI_Hs02_00378777 predicted 177
10 SASI_Hs02_00378778 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378779 predicted 1682
2 SASI_Hs02_00378780 predicted 1287
3 SASI_Hs02_00378781 predicted 1331
4 SASI_Hs02_00378782 predicted 1385
5 SASI_Hs02_00378783 predicted 1670
6 SASI_Hs02_00378784 predicted 1536
7 SASI_Hs02_00378785 predicted 1196
8 SASI_Hs02_00378786 predicted 1887
9 SASI_Hs02_00378787 predicted 1809
10 SASI_Hs02_00378788 predicted 1757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001132
VALIDATED
AFG3L1P MISSION shRNA Bacterial Glycerol Stock
AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-903s1c1
Sequence:CCGGCCGGTTTCATCGCCAGATTTACTCGAGTAAATCTGGCGATGAAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-620s1c1
Sequence:CCGGCGGCTGGAAGTCGTGAACAAACTCGAGTTTGTTCACGACTTCCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001132.1-636s1c1
Sequence:CCGGACAAACAATCTGTGCGTGTTACTCGAGTAACACGCACAGATTGTTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-717s1c1
Sequence:CCGGAGACCCTTCTTGCCAAAGCAACTCGAGTTGCTTTGGCAAGAAGGGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001132.1-987s1c1
Sequence:CCGGGCTGGACAAGAGCCTCAATAACTCGAGTTATTGAGGCTCTTGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001132
VALIDATED
AFG3L1P MISSION shRNA shRNA Plasmid DNA
AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-903s1c1
Sequence:CCGGCCGGTTTCATCGCCAGATTTACTCGAGTAAATCTGGCGATGAAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-620s1c1
Sequence:CCGGCGGCTGGAAGTCGTGAACAAACTCGAGTTTGTTCACGACTTCCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001132.1-636s1c1
Sequence:CCGGACAAACAATCTGTGCGTGTTACTCGAGTAACACGCACAGATTGTTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-717s1c1
Sequence:CCGGAGACCCTTCTTGCCAAAGCAACTCGAGTTGCTTTGGCAAGAAGGGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001132.1-987s1c1
Sequence:CCGGGCTGGACAAGAGCCTCAATAACTCGAGTTATTGAGGCTCTTGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001132
VALIDATED
AFG3L1P MISSION shRNA Lentiviral Transduction Particles
AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-903s1c1
Sequence:CCGGCCGGTTTCATCGCCAGATTTACTCGAGTAAATCTGGCGATGAAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-620s1c1
Sequence:CCGGCGGCTGGAAGTCGTGAACAAACTCGAGTTTGTTCACGACTTCCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001132.1-636s1c1
Sequence:CCGGACAAACAATCTGTGCGTGTTACTCGAGTAACACGCACAGATTGTTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001132.1-717s1c1
Sequence:CCGGAGACCCTTCTTGCCAAAGCAACTCGAGTTGCTTTGGCAAGAAGGGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001132.1-987s1c1
Sequence:CCGGGCTGGACAAGAGCCTCAATAACTCGAGTTATTGAGGCTCTTGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)