EMAIL THIS PAGE TO A FRIEND

AFG3L2

AFG3 ATPase family member 3-like 2 (S. cerevisiae)

Synonyms: SCA28 SPAX5
UniProtKB ID: Q9Y4W6, Q6P1L0
Gene ID:
Human(10939) Summary: This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
Mouse(69597) AFG3(ATPase family gene 3)-like 2 (yeast)
Rat(307350) AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Zebrafish(569168) AFG3 ATPase family gene 3-like 2 (S. cerevisiae)
cow(515757) AFG3 ATPase family gene 3-like 2 (S. cerevisiae)
Horse(100058377) AFG3 ATPase family gene 3-like 2 (S. cerevisiae)
domestic cat(101097676) AFG3 ATPase family gene 3-like 2 (S. cerevisiae)
dog(490560) AFG3 ATPase family gene 3-like 2 (S. cerevisiae)
chicken(421036) AFG3 ATPase family gene 3-like 2 (S. cerevisiae)
naked mole-rat(101720801) AFG3 ATPase family member 3-like 2 (S. cerevisiae)
domestic guinea pig(100733197) AFG3 ATPase family member 3-like 2 (S. cerevisiae)
sheep(101108875) AFG3 ATPase family member 3-like 2 (S. cerevisiae)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006796 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006796 Rosetta Predictions human pricing
NM_001134864 Rosetta Predictions rat pricing
XM_001061139 Rosetta Predictions rat pricing
XM_001061267 Rosetta Predictions rat pricing
XM_001067953 Rosetta Predictions rat pricing
NM_027130 Rosetta Predictions mouse pricing
XM_128950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231520 predicted 1059
2 SASI_Hs01_00231521 predicted 1634
3 SASI_Hs01_00231522 predicted 1758
4 SASI_Hs02_00342311 predicted 770
5 SASI_Hs01_00231523 predicted 1312
6 SASI_Hs01_00231524 predicted 2401
7 SASI_Hs01_00231525 predicted 1221
8 SASI_Hs01_00231526 predicted 1513
9 SASI_Hs01_00231527 predicted 1918
10 SASI_Hs01_00231529 predicted 2419
11 SASI_Hs01_00231528 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258844 predicted 723
2 SASI_Rn02_00258845 predicted 1649
3 SASI_Rn02_00258846 predicted 1364
4 SASI_Rn02_00258847 predicted 693
5 SASI_Rn02_00258848 predicted 790
6 SASI_Rn02_00258849 predicted 1937
7 SASI_Rn02_00258850 predicted 1355
8 SASI_Rn02_00258851 predicted 2262
9 SASI_Rn02_00258852 predicted 1134
10 SASI_Rn02_00258853 predicted 1613
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298898 predicted 686
2 SASI_Rn02_00298899 predicted 1604
3 SASI_Rn02_00298900 predicted 1323
4 SASI_Rn02_00298901 predicted 653
5 SASI_Rn02_00298902 predicted 752
6 SASI_Rn02_00298903 predicted 1784
7 SASI_Rn02_00298904 predicted 1310
8 SASI_Rn02_00298905 predicted 764
9 SASI_Rn02_00298906 predicted 2108
10 SASI_Rn02_00298907 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299421 predicted 724
2 SASI_Rn02_00299422 predicted 1656
3 SASI_Rn02_00299423 predicted 1368
4 SASI_Rn02_00299424 predicted 690
5 SASI_Rn02_00299425 predicted 789
6 SASI_Rn02_00299426 predicted 1939
7 SASI_Rn02_00299427 predicted 1354
8 SASI_Rn02_00299428 predicted 2259
9 SASI_Rn02_00299429 predicted 1134
10 SASI_Rn02_00299430 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322939 predicted 2089
2 SASI_Rn02_00322940 predicted 2096
3 SASI_Rn02_00322941 predicted 2672
4 SASI_Rn02_00322942 predicted 2111
5 SASI_Rn02_00322943 predicted 2630
6 SASI_Rn02_00322944 predicted 2616
7 SASI_Rn02_00322945 predicted 2109
8 SASI_Rn02_00322946 predicted 2653
9 SASI_Rn02_00322947 predicted 2077
10 SASI_Rn02_00322948 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331611 predicted 1083
2 SASI_Mm02_00331612 predicted 1582
3 SASI_Mm02_00331613 predicted 1895
4 SASI_Mm02_00331614 predicted 1747
5 SASI_Mm02_00331615 predicted 752
6 SASI_Mm02_00331616 predicted 653
7 SASI_Mm02_00331617 predicted 683
8 SASI_Mm02_00331618 predicted 895
9 SASI_Mm02_00331619 predicted 2113
10 SASI_Mm02_00331620 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230913 predicted 479
2 SASI_Mm01_00230914 predicted 917
3 SASI_Mm01_00230915 predicted 1419
4 SASI_Mm01_00230916 predicted 1728
5 SASI_Mm01_00230917 predicted 1576
6 SASI_Mm01_00230918 predicted 593
7 SASI_Mm01_00230919 predicted 485
8 SASI_Mm01_00230920 predicted 519
9 SASI_Mm01_00230921 predicted 728
10 SASI_Mm01_00230922 predicted 875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006796
AFG3L2 MISSION shRNA Bacterial Glycerol Stock
AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-222s1c1
Sequence:CCGGCGGACGCTTTACCGATTTGTTCTCGAGAACAAATCGGTAAAGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-999s1c1
Sequence:CCGGGCCAAGGTCTTAAAGGATGAACTCGAGTTCATCCTTTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-1641s1c1
Sequence:CCGGGCATCTTTAACTCCAGGGTTTCTCGAGAAACCCTGGAGTTAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-1059s1c1
Sequence:CCGGGCCAAGCTAGAGATCATGGAACTCGAGTTCCATGATCTCTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-2010s1c1
Sequence:CCGGGCCTCTGAAGAAATCTTCTTTCTCGAGAAAGAAGATTTCTTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006796.1-1272s21c1
Sequence:CCGGGCTAGAGTCCGAGACTTATTTCTCGAGAAATAAGTCTCGGACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006796.1-740s21c1
Sequence:CCGGGCAATACGTTTGGTTTAATATCTCGAGATATTAAACCAAACGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006796
AFG3L2 MISSION shRNA shRNA Plasmid DNA
AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-222s1c1
Sequence:CCGGCGGACGCTTTACCGATTTGTTCTCGAGAACAAATCGGTAAAGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-999s1c1
Sequence:CCGGGCCAAGGTCTTAAAGGATGAACTCGAGTTCATCCTTTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-1641s1c1
Sequence:CCGGGCATCTTTAACTCCAGGGTTTCTCGAGAAACCCTGGAGTTAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-1059s1c1
Sequence:CCGGGCCAAGCTAGAGATCATGGAACTCGAGTTCCATGATCTCTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-2010s1c1
Sequence:CCGGGCCTCTGAAGAAATCTTCTTTCTCGAGAAAGAAGATTTCTTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006796.1-1272s21c1
Sequence:CCGGGCTAGAGTCCGAGACTTATTTCTCGAGAAATAAGTCTCGGACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006796.1-740s21c1
Sequence:CCGGGCAATACGTTTGGTTTAATATCTCGAGATATTAAACCAAACGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006796
AFG3L2 MISSION shRNA Lentiviral Transduction Particles
AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-222s1c1
Sequence:CCGGCGGACGCTTTACCGATTTGTTCTCGAGAACAAATCGGTAAAGCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-999s1c1
Sequence:CCGGGCCAAGGTCTTAAAGGATGAACTCGAGTTCATCCTTTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-1641s1c1
Sequence:CCGGGCATCTTTAACTCCAGGGTTTCTCGAGAAACCCTGGAGTTAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-1059s1c1
Sequence:CCGGGCCAAGCTAGAGATCATGGAACTCGAGTTCCATGATCTCTAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006796.1-2010s1c1
Sequence:CCGGGCCTCTGAAGAAATCTTCTTTCTCGAGAAAGAAGATTTCTTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006796.1-1272s21c1
Sequence:CCGGGCTAGAGTCCGAGACTTATTTCTCGAGAAATAAGTCTCGGACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006796.1-740s21c1
Sequence:CCGGGCAATACGTTTGGTTTAATATCTCGAGATATTAAACCAAACGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027130
VALIDATED
AFG3L2 MISSION shRNA Bacterial Glycerol Stock
AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-758s21c1
Sequence:CCGGGGCAATACGTCTGGTTTAATACTCGAGTATTAAACCAGACGTATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027130.1-654s21c1
Sequence:CCGGCTTTGTCAATAACTATCTTTCCTCGAGGAAAGATAGTTATTGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-848s21c1
Sequence:CCGGACCGGGTCCCTGTGGTTTATACTCGAGTATAAACCACAGGGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027130.1-241s21c1
Sequence:CCGGCTCCGTACGCTCTATCAATATCTCGAGATATTGATAGAGCGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-902s21c1
Sequence:CCGGTGTTGCCCACCGTACTCATTACTCGAGTAATGAGTACGGTGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027130
VALIDATED
AFG3L2 MISSION shRNA shRNA Plasmid DNA
AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-758s21c1
Sequence:CCGGGGCAATACGTCTGGTTTAATACTCGAGTATTAAACCAGACGTATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027130.1-654s21c1
Sequence:CCGGCTTTGTCAATAACTATCTTTCCTCGAGGAAAGATAGTTATTGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-848s21c1
Sequence:CCGGACCGGGTCCCTGTGGTTTATACTCGAGTATAAACCACAGGGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027130.1-241s21c1
Sequence:CCGGCTCCGTACGCTCTATCAATATCTCGAGATATTGATAGAGCGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-902s21c1
Sequence:CCGGTGTTGCCCACCGTACTCATTACTCGAGTAATGAGTACGGTGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027130
VALIDATED
AFG3L2 MISSION shRNA Lentiviral Transduction Particles
AFG3 ATPase family member 3-like 2 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-758s21c1
Sequence:CCGGGGCAATACGTCTGGTTTAATACTCGAGTATTAAACCAGACGTATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027130.1-654s21c1
Sequence:CCGGCTTTGTCAATAACTATCTTTCCTCGAGGAAAGATAGTTATTGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-848s21c1
Sequence:CCGGACCGGGTCCCTGTGGTTTATACTCGAGTATAAACCACAGGGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027130.1-241s21c1
Sequence:CCGGCTCCGTACGCTCTATCAATATCTCGAGATATTGATAGAGCGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027130.1-902s21c1
Sequence:CCGGTGTTGCCCACCGTACTCATTACTCGAGTAATGAGTACGGTGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks