EMAIL THIS PAGE TO A FRIEND

AFM

afamin

65 Gene Product Result for
Synonyms: ALB2 ALBA ALF
UniProtKB ID: P43652, A8K3E1, Q32MR3, Q4W5C5
Gene ID:
Human(173) Summary: This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008]
Mouse(280662) afamin
Rat(282708) afamin
cow(508264) afamin
dog(475175) afamin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0443 AQUA Peptide DADPDTFFA[K] human pricing
AQ0444 AQUA Peptide FLVNLV[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001133 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028191 MISSION® esiRNA esiRNA human AFM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001133 Rosetta Predictions human pricing
NM_172320 Rosetta Predictions rat pricing
NM_145146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167736 predicted 476
2 SASI_Hs01_00167737 predicted 1395
3 SASI_Hs01_00167738 predicted 1623
4 SASI_Hs01_00167739 predicted 736
5 SASI_Hs01_00167740 predicted 462
6 SASI_Hs02_00331219 predicted 1592
7 SASI_Hs01_00167741 predicted 875
8 SASI_Hs02_00331220 predicted 1437
9 SASI_Hs01_00167743 predicted 1104
10 SASI_Hs01_00167744 predicted 978
11 SASI_Hs01_00167742 predicted 1475
12 SASI_Hs01_00167745 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042719 predicted 434
2 SASI_Rn01_00042720 predicted 1439
3 SASI_Rn01_00042721 predicted 1327
4 SASI_Rn01_00042722 predicted 314
5 SASI_Rn02_00269207 predicted 969
6 SASI_Rn01_00042723 predicted 841
7 SASI_Rn02_00269208 predicted 1428
8 SASI_Rn01_00042724 predicted 972
9 SASI_Rn01_00042725 predicted 244
10 SASI_Rn01_00042726 predicted 528
11 SASI_Rn01_00042727 predicted 384
12 SASI_Rn01_00042728 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340545 predicted 474
2 SASI_Mm01_00037842 predicted 704
3 SASI_Mm01_00037844 predicted 908
4 SASI_Mm02_00340546 predicted 1587
5 SASI_Mm01_00037846 predicted 1370
6 SASI_Mm01_00037847 predicted 274
7 SASI_Mm01_00037848 predicted 265
8 SASI_Mm02_00340547 predicted 885
9 SASI_Mm01_00037849 predicted 1617
10 SASI_Mm01_00037845 predicted 1115
11 SASI_Mm01_00037843 predicted 1457
12 SASI_Mm01_00037850 predicted 957
13 SASI_Mm01_00037851 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001133
AFM MISSION shRNA Bacterial Glycerol Stock
afamin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1326s21c1
Sequence:CCGGTCATCAGGCTCACGAAGATAGCTCGAGCTATCTTCGTGAGCCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1469s21c1
Sequence:CCGGGGAGAGTTATGTGGAGTAAATCTCGAGATTTACTCCACATAACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1747s21c1
Sequence:CCGGTTTCGCAAATGTAGTGGATAACTCGAGTTATCCACTACATTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-110s1c1
Sequence:CCGGCGGGATATAGAGAACTTCAATCTCGAGATTGAAGTTCTCTATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-873s1c1
Sequence:CCGGCGAGCAAGGTTATGAACCATACTCGAGTATGGTTCATAACCTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-1673s1c1
Sequence:CCGGGACAGGTTTCTTGTCAACTTACTCGAGTAAGTTGACAAGAAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-203s1c1
Sequence:CCGGGCAACCTTTGAAGAAATGGAACTCGAGTTCCATTTCTTCAAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-1595s1c1
Sequence:CCGGCCACCTTTCTCTCAAGATTTACTCGAGTAAATCTTGAGAGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001133
AFM MISSION shRNA shRNA Plasmid DNA
afamin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1326s21c1
Sequence:CCGGTCATCAGGCTCACGAAGATAGCTCGAGCTATCTTCGTGAGCCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1469s21c1
Sequence:CCGGGGAGAGTTATGTGGAGTAAATCTCGAGATTTACTCCACATAACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1747s21c1
Sequence:CCGGTTTCGCAAATGTAGTGGATAACTCGAGTTATCCACTACATTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-110s1c1
Sequence:CCGGCGGGATATAGAGAACTTCAATCTCGAGATTGAAGTTCTCTATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-873s1c1
Sequence:CCGGCGAGCAAGGTTATGAACCATACTCGAGTATGGTTCATAACCTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-1673s1c1
Sequence:CCGGGACAGGTTTCTTGTCAACTTACTCGAGTAAGTTGACAAGAAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-203s1c1
Sequence:CCGGGCAACCTTTGAAGAAATGGAACTCGAGTTCCATTTCTTCAAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-1595s1c1
Sequence:CCGGCCACCTTTCTCTCAAGATTTACTCGAGTAAATCTTGAGAGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001133
AFM MISSION shRNA Lentiviral Transduction Particles
afamin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1326s21c1
Sequence:CCGGTCATCAGGCTCACGAAGATAGCTCGAGCTATCTTCGTGAGCCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1469s21c1
Sequence:CCGGGGAGAGTTATGTGGAGTAAATCTCGAGATTTACTCCACATAACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001133.2-1747s21c1
Sequence:CCGGTTTCGCAAATGTAGTGGATAACTCGAGTTATCCACTACATTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-110s1c1
Sequence:CCGGCGGGATATAGAGAACTTCAATCTCGAGATTGAAGTTCTCTATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-873s1c1
Sequence:CCGGCGAGCAAGGTTATGAACCATACTCGAGTATGGTTCATAACCTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-1673s1c1
Sequence:CCGGGACAGGTTTCTTGTCAACTTACTCGAGTAAGTTGACAAGAAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-203s1c1
Sequence:CCGGGCAACCTTTGAAGAAATGGAACTCGAGTTCCATTTCTTCAAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001133.2-1595s1c1
Sequence:CCGGCCACCTTTCTCTCAAGATTTACTCGAGTAAATCTTGAGAGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145146
AFM MISSION shRNA Bacterial Glycerol Stock
afamin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-206s1c1
Sequence:CCGGGCATCCTTTGATGAGGTGGAACTCGAGTTCCACCTCATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-804s1c1
Sequence:CCGGCCCTCTTAGAAGATGTTTCTTCTCGAGAAGAAACATCTTCTAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-729s1c1
Sequence:CCGGCCAAGGTCTTAAACTCTATAACTCGAGTTATAGAGTTTAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-728s1c1
Sequence:CCGGCCCAAGGTCTTAAACTCTATACTCGAGTATAGAGTTTAAGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-801s1c1
Sequence:CCGGCCACCCTCTTAGAAGATGTTTCTCGAGAAACATCTTCTAAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145146
AFM MISSION shRNA shRNA Plasmid DNA
afamin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-206s1c1
Sequence:CCGGGCATCCTTTGATGAGGTGGAACTCGAGTTCCACCTCATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-804s1c1
Sequence:CCGGCCCTCTTAGAAGATGTTTCTTCTCGAGAAGAAACATCTTCTAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-729s1c1
Sequence:CCGGCCAAGGTCTTAAACTCTATAACTCGAGTTATAGAGTTTAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-728s1c1
Sequence:CCGGCCCAAGGTCTTAAACTCTATACTCGAGTATAGAGTTTAAGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-801s1c1
Sequence:CCGGCCACCCTCTTAGAAGATGTTTCTCGAGAAACATCTTCTAAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145146
AFM MISSION shRNA Lentiviral Transduction Particles
afamin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-206s1c1
Sequence:CCGGGCATCCTTTGATGAGGTGGAACTCGAGTTCCACCTCATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-804s1c1
Sequence:CCGGCCCTCTTAGAAGATGTTTCTTCTCGAGAAGAAACATCTTCTAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-729s1c1
Sequence:CCGGCCAAGGTCTTAAACTCTATAACTCGAGTTATAGAGTTTAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-728s1c1
Sequence:CCGGCCCAAGGTCTTAAACTCTATACTCGAGTATAGAGTTTAAGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145146.1-801s1c1
Sequence:CCGGCCACCCTCTTAGAAGATGTTTCTCGAGAAACATCTTCTAAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks