EMAIL THIS PAGE TO A FRIEND

AFMID

arylformamidase

46 Gene Product Result for
Synonyms: FKF KF KFA
UniProtKB ID: Q63HM1, A2RUB3
Gene ID:
Mouse(71562) arylformamidase
Rat(688283) arylformamidase
naked mole-rat(101701788) arylformamidase
sheep(101123646) arylformamidase
Zebrafish(550372) arylformamidase
cow(518864) arylformamidase
domestic cat(101081096) arylformamidase
dog(609011) arylformamidase
chicken(769005) arylformamidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010982 Rosetta Predictions human pricing
NM_001111366 Rosetta Predictions rat pricing
NM_027827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094308 predicted 999
2 SASI_Hs01_00094309 predicted 259
3 SASI_Hs01_00094310 predicted 968
4 SASI_Hs01_00094311 predicted 476
5 SASI_Hs01_00094312 predicted 858
6 SASI_Hs01_00094313 predicted 896
7 SASI_Hs01_00094314 predicted 988
8 SASI_Hs01_00094315 predicted 514
9 SASI_Hs01_00094316 predicted 783
10 SASI_Hs01_00094317 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251580 predicted 356
2 SASI_Rn02_00251581 predicted 1217
3 SASI_Rn02_00251582 predicted 853
4 SASI_Rn02_00251583 predicted 483
5 SASI_Rn02_00251584 predicted 489
6 SASI_Rn02_00251585 predicted 865
7 SASI_Rn02_00251586 predicted 1182
8 SASI_Rn02_00251587 predicted 520
9 SASI_Rn02_00251588 predicted 750
10 SASI_Rn02_00251589 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170854 predicted 382
2 SASI_Mm01_00170855 predicted 272
3 SASI_Mm01_00170857 predicted 502
4 SASI_Mm01_00170858 predicted 443
5 SASI_Mm01_00170859 predicted 849
6 SASI_Mm01_00170860 predicted 857
7 SASI_Mm01_00170861 predicted 784
8 SASI_Mm01_00170862 predicted 478
9 SASI_Mm01_00170863 predicted 464
10 SASI_Mm02_00332777 predicted 847
11 SASI_Mm01_00170856 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496246
AFMID MISSION shRNA Bacterial Glycerol Stock
arylformamidase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496246.1-1163s1c1
Sequence:CCGGCGCAAGTCAATGCTCAGAGATCTCGAGATCTCTGAGCATTGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-858s1c1
Sequence:CCGGCCACTTTGAAATTGTTGAGAACTCGAGTTCTCAACAATTTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-900s1c1
Sequence:CCGGGCTCACCCAGATTATCTTGAACTCGAGTTCAAGATAATCTGGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-281s1c1
Sequence:CCGGTCCTGTTCTTTCACGGAGGATCTCGAGATCCTCCGTGAAAGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-456s1c1
Sequence:CCGGGAAGCGGTATCCAAGCAACAACTCGAGTTGTTGCTTGGATACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496246
AFMID MISSION shRNA shRNA Plasmid DNA
arylformamidase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496246.1-1163s1c1
Sequence:CCGGCGCAAGTCAATGCTCAGAGATCTCGAGATCTCTGAGCATTGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-858s1c1
Sequence:CCGGCCACTTTGAAATTGTTGAGAACTCGAGTTCTCAACAATTTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-900s1c1
Sequence:CCGGGCTCACCCAGATTATCTTGAACTCGAGTTCAAGATAATCTGGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-281s1c1
Sequence:CCGGTCCTGTTCTTTCACGGAGGATCTCGAGATCCTCCGTGAAAGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-456s1c1
Sequence:CCGGGAAGCGGTATCCAAGCAACAACTCGAGTTGTTGCTTGGATACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496246
AFMID MISSION shRNA Lentiviral Transduction Particles
arylformamidase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496246.1-1163s1c1
Sequence:CCGGCGCAAGTCAATGCTCAGAGATCTCGAGATCTCTGAGCATTGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-858s1c1
Sequence:CCGGCCACTTTGAAATTGTTGAGAACTCGAGTTCTCAACAATTTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-900s1c1
Sequence:CCGGGCTCACCCAGATTATCTTGAACTCGAGTTCAAGATAATCTGGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-281s1c1
Sequence:CCGGTCCTGTTCTTTCACGGAGGATCTCGAGATCCTCCGTGAAAGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496246.1-456s1c1
Sequence:CCGGGAAGCGGTATCCAAGCAACAACTCGAGTTGTTGCTTGGATACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027827
AFMID MISSION shRNA Bacterial Glycerol Stock
arylformamidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-246s1c1
Sequence:CCGGCTGGACATCTACTTTCCCGATCTCGAGATCGGGAAAGTAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-782s1c1
Sequence:CCGGCCGGCAGTCCAAGGAGTTCTACTCGAGTAGAACTCCTTGGACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-661s1c1
Sequence:CCGGCCCTGGAAGATGCTCAGAGAACTCGAGTTCTCTGAGCATCTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-473s1c1
Sequence:CCGGCTATCCAAGCAATGAGGGAATCTCGAGATTCCCTCATTGCTTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-144s1c1
Sequence:CCGGGTTGGGAACTTCGTGCAGATACTCGAGTATCTGCACGAAGTTCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027827
AFMID MISSION shRNA shRNA Plasmid DNA
arylformamidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-246s1c1
Sequence:CCGGCTGGACATCTACTTTCCCGATCTCGAGATCGGGAAAGTAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-782s1c1
Sequence:CCGGCCGGCAGTCCAAGGAGTTCTACTCGAGTAGAACTCCTTGGACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-661s1c1
Sequence:CCGGCCCTGGAAGATGCTCAGAGAACTCGAGTTCTCTGAGCATCTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-473s1c1
Sequence:CCGGCTATCCAAGCAATGAGGGAATCTCGAGATTCCCTCATTGCTTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-144s1c1
Sequence:CCGGGTTGGGAACTTCGTGCAGATACTCGAGTATCTGCACGAAGTTCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027827
AFMID MISSION shRNA Lentiviral Transduction Particles
arylformamidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-246s1c1
Sequence:CCGGCTGGACATCTACTTTCCCGATCTCGAGATCGGGAAAGTAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-782s1c1
Sequence:CCGGCCGGCAGTCCAAGGAGTTCTACTCGAGTAGAACTCCTTGGACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-661s1c1
Sequence:CCGGCCCTGGAAGATGCTCAGAGAACTCGAGTTCTCTGAGCATCTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-473s1c1
Sequence:CCGGCTATCCAAGCAATGAGGGAATCTCGAGATTCCCTCATTGCTTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027827.2-144s1c1
Sequence:CCGGGTTGGGAACTTCGTGCAGATACTCGAGTATCTGCACGAAGTTCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks