EMAIL THIS PAGE TO A FRIEND

AFP

alpha-fetoprotein

69 Gene Product Result for
Synonyms: FETA HPAFP
UniProtKB ID: P02771, B2RBU3
Gene ID:
Human(174) Summary: This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatoma or teratoma. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Jul 2008]
Mouse(11576) alpha fetoprotein
Rat(24177) alpha-fetoprotein
chicken(422652) alpha-fetoprotein
cow(506011) alpha-fetoprotein
Horse(100034185) alpha-fetoprotein
dog(403551) alpha-fetoprotein
Domestic Rabbit(100345865) alpha-fetoprotein
domestic guinea pig(100728693) alpha-fetoprotein
naked mole-rat(101725205) alpha-fetoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200746 Anti-α-Fetoprotein (AFP) antibody, Mouse monoclonal clone C3, purified from hybridoma cell culture New porcine, canine, human
dot blot, ELISA, immunofluorescence, immunohistochemistry, western blot pricing
GW22680 Anti-AFP antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA010607 Anti-AFP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA023600 Anti-AFP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500533 Anti-AFP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500004 Anti-Alpha-Fetoprotein antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP154, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
A8452 Monoclonal Anti-α-Fetoprotein (AFP) antibody produced in mouse ascites fluid, clone C3 pig, canine, human
dot blot, ELISA, immunohistochemistry pricing
WH0000174M1 Monoclonal Anti-AFP antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB3300008 Monoclonal Anti-AFP antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB1403529 Monoclonal Anti-AFP, (C-terminal) antibody produced in mouse clone 1A24, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046191 MISSION® esiRNA esiRNA human AFP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001134 Rosetta Predictions human pricing
NM_012493 Rosetta Predictions rat pricing
NM_007423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236592 predicted 559
2 SASI_Hs02_00331221 predicted 1178
3 SASI_Hs01_00236593 predicted 1215
4 SASI_Hs01_00236594 predicted 710
5 SASI_Hs01_00236595 predicted 638
6 SASI_Hs02_00331222 predicted 1018
7 SASI_Hs01_00236596 predicted 239
8 SASI_Hs01_00236597 predicted 253
9 SASI_Hs01_00236598 predicted 1489
10 SASI_Hs01_00236599 predicted 1300
11 SASI_Hs01_00236591 predicted 486
12 SASI_Hs01_00236600 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039912 predicted 542
2 SASI_Rn01_00039913 predicted 999
3 SASI_Rn01_00039914 predicted 740
4 SASI_Rn01_00039915 predicted 1282
5 SASI_Rn02_00259528 predicted 620
6 SASI_Rn01_00039916 predicted 1501
7 SASI_Rn01_00039918 predicted 1186
8 SASI_Rn02_00259529 predicted 997
9 SASI_Rn01_00039919 predicted 289
10 SASI_Rn01_00039920 predicted 1465
11 SASI_Rn01_00039917 predicted 1672
12 SASI_Rn01_00039921 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311569 predicted 767
2 SASI_Mm01_00116830 predicted 971
3 SASI_Mm02_00311570 predicted 535
4 SASI_Mm01_00116831 predicted 516
5 SASI_Mm01_00116832 predicted 1023
6 SASI_Mm02_00311571 predicted 716
7 SASI_Mm01_00116834 predicted 669
8 SASI_Mm01_00116835 predicted 1193
9 SASI_Mm01_00116837 predicted 702
10 SASI_Mm01_00116838 predicted 966
11 SASI_Mm01_00116833 predicted 1298
12 SASI_Mm01_00116836 predicted 1075
13 SASI_Mm01_00116839 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134
AFP MISSION shRNA Bacterial Glycerol Stock
alpha-fetoprotein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-1214s1c1
Sequence:CCGGCCCTCTTGAATGCCAAGATAACTCGAGTTATCTTGGCATTCAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-559s1c1
Sequence:CCGGCCTTCCTGTATGCACCTACAACTCGAGTTGTAGGTGCATACAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-1683s1c1
Sequence:CCGGCAAACGATGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCATCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-136s1c1
Sequence:CCGGCCATATTGGATTCTTACCAATCTCGAGATTGGTAAGAATCCAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-321s1c1
Sequence:CCGGCCTGCCTTTCTGGAAGAACTTCTCGAGAAGTTCTTCCAGAAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134.1-359s21c1
Sequence:CCGGTTTGGAGAAGTACGGACATTCCTCGAGGAATGTCCGTACTTCTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134.1-177s21c1
Sequence:CCGGGCTGACCTGGCTACCATATTTCTCGAGAAATATGGTAGCCAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134
AFP MISSION shRNA shRNA Plasmid DNA
alpha-fetoprotein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-1214s1c1
Sequence:CCGGCCCTCTTGAATGCCAAGATAACTCGAGTTATCTTGGCATTCAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-559s1c1
Sequence:CCGGCCTTCCTGTATGCACCTACAACTCGAGTTGTAGGTGCATACAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-1683s1c1
Sequence:CCGGCAAACGATGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCATCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-136s1c1
Sequence:CCGGCCATATTGGATTCTTACCAATCTCGAGATTGGTAAGAATCCAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-321s1c1
Sequence:CCGGCCTGCCTTTCTGGAAGAACTTCTCGAGAAGTTCTTCCAGAAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134.1-359s21c1
Sequence:CCGGTTTGGAGAAGTACGGACATTCCTCGAGGAATGTCCGTACTTCTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134.1-177s21c1
Sequence:CCGGGCTGACCTGGCTACCATATTTCTCGAGAAATATGGTAGCCAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134
AFP MISSION shRNA Lentiviral Transduction Particles
alpha-fetoprotein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-1214s1c1
Sequence:CCGGCCCTCTTGAATGCCAAGATAACTCGAGTTATCTTGGCATTCAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-559s1c1
Sequence:CCGGCCTTCCTGTATGCACCTACAACTCGAGTTGTAGGTGCATACAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-1683s1c1
Sequence:CCGGCAAACGATGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCATCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-136s1c1
Sequence:CCGGCCATATTGGATTCTTACCAATCTCGAGATTGGTAAGAATCCAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001134.1-321s1c1
Sequence:CCGGCCTGCCTTTCTGGAAGAACTTCTCGAGAAGTTCTTCCAGAAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134.1-359s21c1
Sequence:CCGGTTTGGAGAAGTACGGACATTCCTCGAGGAATGTCCGTACTTCTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134.1-177s21c1
Sequence:CCGGGCTGACCTGGCTACCATATTTCTCGAGAAATATGGTAGCCAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007423
AFP MISSION shRNA Bacterial Glycerol Stock
alpha-fetoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-738s1c1
Sequence:CCGGCCAGGCAACAACCATTATTAACTCGAGTTAATAATGGTTGTTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-1290s1c1
Sequence:CCGGCCAGACCTTAGGAGACTACAACTCGAGTTGTAGTCTCCTAAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-992s1c1
Sequence:CCGGGCGTCAAACCTGAAGGCTTATCTCGAGATAAGCCTTCAGGTTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-683s1c1
Sequence:CCGGGCATGTTAAATGAGCATGTATCTCGAGATACATGCTCATTTAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-95s1c1
Sequence:CCGGCGTCCAAAGCATTGCACGAAACTCGAGTTTCGTGCAATGCTTTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007423
AFP MISSION shRNA shRNA Plasmid DNA
alpha-fetoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-738s1c1
Sequence:CCGGCCAGGCAACAACCATTATTAACTCGAGTTAATAATGGTTGTTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-1290s1c1
Sequence:CCGGCCAGACCTTAGGAGACTACAACTCGAGTTGTAGTCTCCTAAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-992s1c1
Sequence:CCGGGCGTCAAACCTGAAGGCTTATCTCGAGATAAGCCTTCAGGTTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-683s1c1
Sequence:CCGGGCATGTTAAATGAGCATGTATCTCGAGATACATGCTCATTTAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-95s1c1
Sequence:CCGGCGTCCAAAGCATTGCACGAAACTCGAGTTTCGTGCAATGCTTTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007423
AFP MISSION shRNA Lentiviral Transduction Particles
alpha-fetoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-738s1c1
Sequence:CCGGCCAGGCAACAACCATTATTAACTCGAGTTAATAATGGTTGTTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-1290s1c1
Sequence:CCGGCCAGACCTTAGGAGACTACAACTCGAGTTGTAGTCTCCTAAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-992s1c1
Sequence:CCGGGCGTCAAACCTGAAGGCTTATCTCGAGATAAGCCTTCAGGTTTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-683s1c1
Sequence:CCGGGCATGTTAAATGAGCATGTATCTCGAGATACATGCTCATTTAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007423.2-95s1c1
Sequence:CCGGCGTCCAAAGCATTGCACGAAACTCGAGTTTCGTGCAATGCTTTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)