EMAIL THIS PAGE TO A FRIEND

AFTPH

aftiphilin

129 Gene Product Result for
Synonyms: Nbla10388
Gene ID:
Mouse(216549) aftiphilin
Rat(305544) aftiphilin
chicken(421277) aftiphilin
dog(474618) aftiphilin
cow(540837) aftiphilin
Horse(100063526) aftiphilin
sheep(101114001) aftiphilin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002243 Rosetta Predictions human pricing
NM_017657 Rosetta Predictions human pricing
NM_203437 Rosetta Predictions human pricing
XM_001055784 Rosetta Predictions rat pricing
XM_223651 Rosetta Predictions rat pricing
NM_181411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078019 predicted 947
2 SASI_Hs01_00078020 predicted 1226
3 SASI_Hs01_00078021 predicted 1389
4 SASI_Hs01_00078022 predicted 2173
5 SASI_Hs01_00078024 predicted 2425
6 SASI_Hs01_00078025 predicted 1151
7 SASI_Hs01_00078026 predicted 1523
8 SASI_Hs02_00304132 predicted 2014
9 SASI_Hs02_00304133 predicted 1664
10 SASI_Hs01_00078027 predicted 2218
11 SASI_Hs01_00078018 predicted 1474
12 SASI_Hs01_00078023 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019743 predicted 950
2 SASI_Hs01_00019744 predicted 1224
3 SASI_Hs01_00019745 predicted 1390
4 SASI_Hs01_00019746 predicted 2175
5 SASI_Hs01_00019748 predicted 2428
6 SASI_Hs01_00019749 predicted 1158
7 SASI_Hs01_00019750 predicted 1527
8 SASI_Hs02_00350369 predicted 2017
9 SASI_Hs02_00350370 predicted 1664
10 SASI_Hs01_00019751 predicted 2223
11 SASI_Hs01_00019742 predicted 1466
12 SASI_Hs01_00019747 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016697 predicted 949
2 SASI_Hs01_00016698 predicted 1225
3 SASI_Hs01_00016699 predicted 1390
4 SASI_Hs01_00016700 predicted 2171
5 SASI_Hs01_00016702 predicted 2431
6 SASI_Hs01_00016703 predicted 1152
7 SASI_Hs01_00016704 predicted 1530
8 SASI_Hs02_00373369 predicted 2010
9 SASI_Hs02_00373370 predicted 1669
10 SASI_Hs01_00016705 predicted 2220
11 SASI_Hs01_00016696 predicted 1472
12 SASI_Hs01_00016701 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280995 predicted 3165
2 SASI_Rn02_00280996 predicted 513
3 SASI_Rn02_00280997 predicted 1379
4 SASI_Rn02_00280998 predicted 1634
5 SASI_Rn02_00280999 predicted 2329
6 SASI_Rn02_00281000 predicted 473
7 SASI_Rn02_00281001 predicted 738
8 SASI_Rn02_00281002 predicted 2680
9 SASI_Rn02_00281003 predicted 2792
10 SASI_Rn02_00281004 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381557 predicted 3165
2 SASI_Rn02_00381558 predicted 507
3 SASI_Rn02_00381559 predicted 1375
4 SASI_Rn02_00381560 predicted 1633
5 SASI_Rn02_00381561 predicted 2335
6 SASI_Rn02_00381562 predicted 475
7 SASI_Rn02_00381563 predicted 732
8 SASI_Rn02_00381564 predicted 2681
9 SASI_Rn02_00381565 predicted 2796
10 SASI_Rn02_00381566 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349759 predicted 1472
2 SASI_Mm01_00117114 predicted 1563
3 SASI_Mm01_00117115 predicted 458
4 SASI_Mm01_00117116 predicted 405
5 SASI_Mm01_00117117 predicted 399
6 SASI_Mm01_00117118 predicted 2610
7 SASI_Mm01_00117119 predicted 1925
8 SASI_Mm02_00349760 predicted 1650
9 SASI_Mm01_00117121 predicted 453
10 SASI_Mm01_00117122 predicted 803
11 SASI_Mm01_00117113 predicted 1036
12 SASI_Mm01_00117120 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017657
VALIDATED
AFTPH MISSION shRNA Bacterial Glycerol Stock
aftiphilin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-682s21c1
Sequence:CCGGCTTCCATTGATGGCATGGAAACTCGAGTTTCCATGCCATCAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-1222s21c1
Sequence:CCGGGCATAGTGACTAACAGAGGTTCTCGAGAACCTCTGTTAGTCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-2295s21c1
Sequence:CCGGCCTTCCATACTTGTCCCTGATCTCGAGATCAGGGACAAGTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-447s21c1
Sequence:CCGGGTTGATTTCGATACACCAGATCTCGAGATCTGGTGTATCGAAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-447s1c1
Sequence:CCGGGTTGATTTCGATACACCAGATCTCGAGATCTGGTGTATCGAAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017657.2-1456s1c1
Sequence:CCGGGTTCTCCCAAAGAAGAAAGTACTCGAGTACTTTCTTCTTTGGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017657.2-1335s1c1
Sequence:CCGGGCTGATAATTCAGAAGCCATTCTCGAGAATGGCTTCTGAATTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-682s1c1
Sequence:CCGGCTTCCATTGATGGCATGGAAACTCGAGTTTCCATGCCATCAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2779s1c1
Sequence:CCGGCGGAGTTGTATGAGTTAACAACTCGAGTTGTTAACTCATACAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-579s1c1
Sequence:CCGGGATAAGGACATCACTGCTGAACTCGAGTTCAGCAGTGATGTCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017657.2-1222s1c1
Sequence:CCGGGCATAGTGACTAACAGAGGTTCTCGAGAACCTCTGTTAGTCACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2295s1c1
Sequence:CCGGCCTTCCATACTTGTCCCTGATCTCGAGATCAGGGACAAGTATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2236s1c1
Sequence:CCGGCCACTTCAGTTCAGACAGCTTCTCGAGAAGCTGTCTGAACTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-2539s1c1
Sequence:CCGGGCAATAAGAAGCAGCCTGTTACTCGAGTAACAGGCTGCTTCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017657
VALIDATED
AFTPH MISSION shRNA shRNA Plasmid DNA
aftiphilin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-682s21c1
Sequence:CCGGCTTCCATTGATGGCATGGAAACTCGAGTTTCCATGCCATCAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-1222s21c1
Sequence:CCGGGCATAGTGACTAACAGAGGTTCTCGAGAACCTCTGTTAGTCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-2295s21c1
Sequence:CCGGCCTTCCATACTTGTCCCTGATCTCGAGATCAGGGACAAGTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-447s21c1
Sequence:CCGGGTTGATTTCGATACACCAGATCTCGAGATCTGGTGTATCGAAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-447s1c1
Sequence:CCGGGTTGATTTCGATACACCAGATCTCGAGATCTGGTGTATCGAAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017657.2-1456s1c1
Sequence:CCGGGTTCTCCCAAAGAAGAAAGTACTCGAGTACTTTCTTCTTTGGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017657.2-1335s1c1
Sequence:CCGGGCTGATAATTCAGAAGCCATTCTCGAGAATGGCTTCTGAATTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-682s1c1
Sequence:CCGGCTTCCATTGATGGCATGGAAACTCGAGTTTCCATGCCATCAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2779s1c1
Sequence:CCGGCGGAGTTGTATGAGTTAACAACTCGAGTTGTTAACTCATACAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-579s1c1
Sequence:CCGGGATAAGGACATCACTGCTGAACTCGAGTTCAGCAGTGATGTCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017657.2-1222s1c1
Sequence:CCGGGCATAGTGACTAACAGAGGTTCTCGAGAACCTCTGTTAGTCACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2295s1c1
Sequence:CCGGCCTTCCATACTTGTCCCTGATCTCGAGATCAGGGACAAGTATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2236s1c1
Sequence:CCGGCCACTTCAGTTCAGACAGCTTCTCGAGAAGCTGTCTGAACTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-2539s1c1
Sequence:CCGGGCAATAAGAAGCAGCCTGTTACTCGAGTAACAGGCTGCTTCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017657
VALIDATED
AFTPH MISSION shRNA Lentiviral Transduction Particles
aftiphilin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-682s21c1
Sequence:CCGGCTTCCATTGATGGCATGGAAACTCGAGTTTCCATGCCATCAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-1222s21c1
Sequence:CCGGGCATAGTGACTAACAGAGGTTCTCGAGAACCTCTGTTAGTCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-2295s21c1
Sequence:CCGGCCTTCCATACTTGTCCCTGATCTCGAGATCAGGGACAAGTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017657.3-447s21c1
Sequence:CCGGGTTGATTTCGATACACCAGATCTCGAGATCTGGTGTATCGAAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-447s1c1
Sequence:CCGGGTTGATTTCGATACACCAGATCTCGAGATCTGGTGTATCGAAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017657.2-1456s1c1
Sequence:CCGGGTTCTCCCAAAGAAGAAAGTACTCGAGTACTTTCTTCTTTGGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017657.2-1335s1c1
Sequence:CCGGGCTGATAATTCAGAAGCCATTCTCGAGAATGGCTTCTGAATTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-682s1c1
Sequence:CCGGCTTCCATTGATGGCATGGAAACTCGAGTTTCCATGCCATCAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2779s1c1
Sequence:CCGGCGGAGTTGTATGAGTTAACAACTCGAGTTGTTAACTCATACAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-579s1c1
Sequence:CCGGGATAAGGACATCACTGCTGAACTCGAGTTCAGCAGTGATGTCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017657.2-1222s1c1
Sequence:CCGGGCATAGTGACTAACAGAGGTTCTCGAGAACCTCTGTTAGTCACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2295s1c1
Sequence:CCGGCCTTCCATACTTGTCCCTGATCTCGAGATCAGGGACAAGTATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017657.2-2236s1c1
Sequence:CCGGCCACTTCAGTTCAGACAGCTTCTCGAGAAGCTGTCTGAACTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017657.2-2539s1c1
Sequence:CCGGGCAATAAGAAGCAGCCTGTTACTCGAGTAACAGGCTGCTTCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181411
VALIDATED
AFTPH MISSION shRNA Bacterial Glycerol Stock
aftiphilin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-884s21c1
Sequence:CCGGGCTAGTCATGCTACGGAATTTCTCGAGAAATTCCGTAGCATGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-435s21c1
Sequence:CCGGTAGATAGCCTTACAAGCTTTACTCGAGTAAAGCTTGTAAGGCTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-2482s21c1
Sequence:CCGGGCCCACCAAGGAACCATTAAACTCGAGTTTAATGGTTCCTTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181411.2-3090s21c1
Sequence:CCGGACATACCGAAGTCCTAAATTTCTCGAGAAATTTAGGACTTCGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-1172s21c1
Sequence:CCGGCAACAGGATGAGTTTCTAAATCTCGAGATTTAGAAACTCATCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-2548s1c1
Sequence:CCGGCGTTATGACACCAGAAATAAACTCGAGTTTATTTCTGGTGTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-2438s1c1
Sequence:CCGGCCTGTTATAGTGCCCATGTATCTCGAGATACATGGGCACTATAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-546s1c1
Sequence:CCGGGCAAAGAAATGATTCCATCTACTCGAGTAGATGGAATCATTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181411.2-1172s1c1
Sequence:CCGGCAACAGGATGAGTTTCTAAATCTCGAGATTTAGAAACTCATCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181411
VALIDATED
AFTPH MISSION shRNA shRNA Plasmid DNA
aftiphilin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-884s21c1
Sequence:CCGGGCTAGTCATGCTACGGAATTTCTCGAGAAATTCCGTAGCATGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-435s21c1
Sequence:CCGGTAGATAGCCTTACAAGCTTTACTCGAGTAAAGCTTGTAAGGCTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-2482s21c1
Sequence:CCGGGCCCACCAAGGAACCATTAAACTCGAGTTTAATGGTTCCTTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181411.2-3090s21c1
Sequence:CCGGACATACCGAAGTCCTAAATTTCTCGAGAAATTTAGGACTTCGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-1172s21c1
Sequence:CCGGCAACAGGATGAGTTTCTAAATCTCGAGATTTAGAAACTCATCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-2548s1c1
Sequence:CCGGCGTTATGACACCAGAAATAAACTCGAGTTTATTTCTGGTGTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-2438s1c1
Sequence:CCGGCCTGTTATAGTGCCCATGTATCTCGAGATACATGGGCACTATAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-546s1c1
Sequence:CCGGGCAAAGAAATGATTCCATCTACTCGAGTAGATGGAATCATTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181411.2-1172s1c1
Sequence:CCGGCAACAGGATGAGTTTCTAAATCTCGAGATTTAGAAACTCATCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181411
VALIDATED
AFTPH MISSION shRNA Lentiviral Transduction Particles
aftiphilin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-884s21c1
Sequence:CCGGGCTAGTCATGCTACGGAATTTCTCGAGAAATTCCGTAGCATGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-435s21c1
Sequence:CCGGTAGATAGCCTTACAAGCTTTACTCGAGTAAAGCTTGTAAGGCTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-2482s21c1
Sequence:CCGGGCCCACCAAGGAACCATTAAACTCGAGTTTAATGGTTCCTTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181411.2-3090s21c1
Sequence:CCGGACATACCGAAGTCCTAAATTTCTCGAGAAATTTAGGACTTCGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181411.2-1172s21c1
Sequence:CCGGCAACAGGATGAGTTTCTAAATCTCGAGATTTAGAAACTCATCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-2548s1c1
Sequence:CCGGCGTTATGACACCAGAAATAAACTCGAGTTTATTTCTGGTGTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-2438s1c1
Sequence:CCGGCCTGTTATAGTGCCCATGTATCTCGAGATACATGGGCACTATAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181411.2-546s1c1
Sequence:CCGGGCAAAGAAATGATTCCATCTACTCGAGTAGATGGAATCATTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181411.2-1172s1c1
Sequence:CCGGCAACAGGATGAGTTTCTAAATCTCGAGATTTAGAAACTCATCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks