EMAIL THIS PAGE TO A FRIEND

AGAP11

ankyrin repeat and GTPase domain Arf GTPase activating protein 11

55 Gene Product Result for
Species: Human AGAP11(119385)
UniProtKB ID: Q8TF27, B9EIP7, D3DWE4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305936 ANTI-AGAP11 (N-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133447 Rosetta Predictions human pricing
XM_370567 Rosetta Predictions human pricing
XM_931482 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363124 predicted 1846
2 SASI_Hs02_00363125 predicted 1259
3 SASI_Hs02_00363126 predicted 1289
4 SASI_Hs02_00363127 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269736 predicted 1822
2 SASI_Hs01_00269737 predicted 1847
3 SASI_Hs01_00269738 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253379 predicted 566
2 SASI_Hs01_00253380 predicted 1008
3 SASI_Hs01_00253381 predicted 568
4 SASI_Hs01_00253382 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133447
AGAP11 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and GTPase domain Arf GTPase activating protein 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-2047s21c1
Sequence:CCGGTGGCCAAACGTGCCACTTTAACTCGAGTTAAAGTGGCACGTTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1391s21c1
Sequence:CCGGACCAGCCAGGAGGACCTTTATCTCGAGATAAAGGTCCTCCTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1276s21c1
Sequence:CCGGCATACTTGATGAACAGTTATACTCGAGTATAACTGTTCATCAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1234s21c1
Sequence:CCGGACATCATCATATCACGGAAAGCTCGAGCTTTCCGTGATATGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1816s21c1
Sequence:CCGGGGACATGGAAGCTCTGCATATCTCGAGATATGCAGAGCTTCCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133447
AGAP11 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and GTPase domain Arf GTPase activating protein 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-2047s21c1
Sequence:CCGGTGGCCAAACGTGCCACTTTAACTCGAGTTAAAGTGGCACGTTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1391s21c1
Sequence:CCGGACCAGCCAGGAGGACCTTTATCTCGAGATAAAGGTCCTCCTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1276s21c1
Sequence:CCGGCATACTTGATGAACAGTTATACTCGAGTATAACTGTTCATCAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1234s21c1
Sequence:CCGGACATCATCATATCACGGAAAGCTCGAGCTTTCCGTGATATGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1816s21c1
Sequence:CCGGGGACATGGAAGCTCTGCATATCTCGAGATATGCAGAGCTTCCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133447
AGAP11 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and GTPase domain Arf GTPase activating protein 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-2047s21c1
Sequence:CCGGTGGCCAAACGTGCCACTTTAACTCGAGTTAAAGTGGCACGTTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1391s21c1
Sequence:CCGGACCAGCCAGGAGGACCTTTATCTCGAGATAAAGGTCCTCCTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1276s21c1
Sequence:CCGGCATACTTGATGAACAGTTATACTCGAGTATAACTGTTCATCAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1234s21c1
Sequence:CCGGACATCATCATATCACGGAAAGCTCGAGCTTTCCGTGATATGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133447.1-1816s21c1
Sequence:CCGGGGACATGGAAGCTCTGCATATCTCGAGATATGCAGAGCTTCCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks