EMAIL THIS PAGE TO A FRIEND

AGAP1

ArfGAP with GTPase domain, ankyrin repeat and PH domain 1

123 Gene Product Result for
Synonyms: AGAP-1 CENTG2 GGAP1 cnt-g2
UniProtKB ID: Q9UPQ3, B2RTX7, Q541S5, Q6P9D7, Q9NV93
Gene ID:
Human(116987) Summary: This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(347722) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Rat(316611) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Zebrafish(100148154) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
domestic cat(101080564) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
dog(606892) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
chicken(424024) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
sheep(101111683) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Domestic Rabbit(100344961) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
domestic guinea pig(100730105) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
naked mole-rat(101714494) ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014914 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037131 Rosetta Predictions human pricing
NM_014914 Rosetta Predictions human pricing
NM_001108230 Rosetta Predictions rat pricing
NM_001037136 Rosetta Predictions mouse pricing
NM_178119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071433 predicted 1464
2 SASI_Hs01_00071434 predicted 912
3 SASI_Hs01_00071436 predicted 1644
4 SASI_Hs02_00308213 predicted 1658
5 SASI_Hs01_00071437 predicted 1004
6 SASI_Hs02_00308214 predicted 1041
7 SASI_Hs01_00071438 predicted 1415
8 SASI_Hs01_00071439 predicted 3100
9 SASI_Hs01_00071440 predicted 1383
10 SASI_Hs01_00071441 predicted 822
11 SASI_Hs01_00071435 predicted 2566
12 SASI_Hs01_00071442 predicted 2623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155539 predicted 1455
2 SASI_Hs01_00155540 predicted 913
3 SASI_Hs01_00155542 predicted 1642
4 SASI_Hs02_00346556 predicted 1662
5 SASI_Hs01_00155543 predicted 1007
6 SASI_Hs02_00346557 predicted 1037
7 SASI_Hs01_00155544 predicted 1422
8 SASI_Hs01_00155545 predicted 2944
9 SASI_Hs01_00155546 predicted 1378
10 SASI_Hs01_00155547 predicted 823
11 SASI_Hs01_00155541 predicted 2406
12 SASI_Hs01_00155548 predicted 2459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236604 predicted 776
2 SASI_Rn02_00236605 predicted 2124
3 SASI_Rn02_00236606 predicted 1508
4 SASI_Rn02_00236607 predicted 1811
5 SASI_Rn02_00236608 predicted 1011
6 SASI_Rn02_00236609 predicted 655
7 SASI_Rn02_00236610 predicted 1023
8 SASI_Rn02_00236611 predicted 294
9 SASI_Rn02_00236612 predicted 1123
10 SASI_Rn02_00236613 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129984 predicted 1566
2 SASI_Mm01_00129985 predicted 1434
3 SASI_Mm02_00289287 predicted 2907
4 SASI_Mm01_00129986 predicted 1083
5 SASI_Mm01_00129987 predicted 851
6 SASI_Mm01_00129988 predicted 1291
7 SASI_Mm01_00129989 predicted 1057
8 SASI_Mm01_00129990 predicted 926
9 SASI_Mm01_00129991 predicted 2348
10 SASI_Mm01_00129992 predicted 1345
11 SASI_Mm01_00129993 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071665 predicted 1561
2 SASI_Mm01_00071666 predicted 1433
3 SASI_Mm02_00348591 predicted 3063
4 SASI_Mm01_00071667 predicted 1080
5 SASI_Mm01_00071668 predicted 851
6 SASI_Mm01_00071669 predicted 1297
7 SASI_Mm01_00071670 predicted 1052
8 SASI_Mm01_00071671 predicted 927
9 SASI_Mm01_00071672 predicted 2506
10 SASI_Mm01_00071673 predicted 1349
11 SASI_Mm01_00071674 predicted 2412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178119
VALIDATED
AGAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-2410s21c1
Sequence:GTACCGGCAAGAATAAGTCCCGACTAACCTCGAGGTTAGTCGGGACTTATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1552s21c1
Sequence:CCGGCAAGCGCAGGTCCAACCTATTCTCGAGAATAGGTTGGACCTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-966s21c1
Sequence:CCGGAGAGTTATCTGCTGCTGATTACTCGAGTAATCAGCAGCAGATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178119.3-3752s21c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178119.3-1075s21c1
Sequence:CCGGCCAGACTGTCTACCATTACTACTCGAGTAGTAATGGTAGACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1919s21c1
Sequence:CCGGAGTTTACACATCTCACCAAATCTCGAGATTTGGTGAGATGTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1224s21c1
Sequence:GTACCGGTGAAGAGGTGCACGTACTATGCTCGAGCATAGTACGTGCACCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178119.2-3713s1c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178119.2-2370s1c1
Sequence:CCGGGCAAGAATAAGTCCCGACTAACTCGAGTTAGTCGGGACTTATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178119.2-1865s1c1
Sequence:CCGGGCCAAGGACATGAGCAGTTTACTCGAGTAAACTGCTCATGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178119.2-1036s1c1
Sequence:CCGGCCAGACTGTCTACCATTACTACTCGAGTAGTAATGGTAGACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178119.2-1880s1c1
Sequence:CCGGAGTTTACACATCTCACCAAATCTCGAGATTTGGTGAGATGTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178119
VALIDATED
AGAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-2410s21c1
Sequence:GTACCGGCAAGAATAAGTCCCGACTAACCTCGAGGTTAGTCGGGACTTATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1552s21c1
Sequence:CCGGCAAGCGCAGGTCCAACCTATTCTCGAGAATAGGTTGGACCTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-966s21c1
Sequence:CCGGAGAGTTATCTGCTGCTGATTACTCGAGTAATCAGCAGCAGATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178119.3-3752s21c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178119.3-1075s21c1
Sequence:CCGGCCAGACTGTCTACCATTACTACTCGAGTAGTAATGGTAGACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1919s21c1
Sequence:CCGGAGTTTACACATCTCACCAAATCTCGAGATTTGGTGAGATGTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1224s21c1
Sequence:GTACCGGTGAAGAGGTGCACGTACTATGCTCGAGCATAGTACGTGCACCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178119.2-3713s1c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178119.2-2370s1c1
Sequence:CCGGGCAAGAATAAGTCCCGACTAACTCGAGTTAGTCGGGACTTATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178119.2-1865s1c1
Sequence:CCGGGCCAAGGACATGAGCAGTTTACTCGAGTAAACTGCTCATGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178119.2-1036s1c1
Sequence:CCGGCCAGACTGTCTACCATTACTACTCGAGTAGTAATGGTAGACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178119.2-1880s1c1
Sequence:CCGGAGTTTACACATCTCACCAAATCTCGAGATTTGGTGAGATGTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178119
VALIDATED
AGAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-2410s21c1
Sequence:GTACCGGCAAGAATAAGTCCCGACTAACCTCGAGGTTAGTCGGGACTTATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1552s21c1
Sequence:CCGGCAAGCGCAGGTCCAACCTATTCTCGAGAATAGGTTGGACCTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-966s21c1
Sequence:CCGGAGAGTTATCTGCTGCTGATTACTCGAGTAATCAGCAGCAGATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178119.3-3752s21c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178119.3-1075s21c1
Sequence:CCGGCCAGACTGTCTACCATTACTACTCGAGTAGTAATGGTAGACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1919s21c1
Sequence:CCGGAGTTTACACATCTCACCAAATCTCGAGATTTGGTGAGATGTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178119.3-1224s21c1
Sequence:GTACCGGTGAAGAGGTGCACGTACTATGCTCGAGCATAGTACGTGCACCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178119.2-3713s1c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178119.2-2370s1c1
Sequence:CCGGGCAAGAATAAGTCCCGACTAACTCGAGTTAGTCGGGACTTATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178119.2-1865s1c1
Sequence:CCGGGCCAAGGACATGAGCAGTTTACTCGAGTAAACTGCTCATGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178119.2-1036s1c1
Sequence:CCGGCCAGACTGTCTACCATTACTACTCGAGTAGTAATGGTAGACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178119.2-1880s1c1
Sequence:CCGGAGTTTACACATCTCACCAAATCTCGAGATTTGGTGAGATGTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014914
VALIDATED
AGAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-1320s21c1
Sequence:CCGGCCTGCAAGTCGCTACCTAATTCTCGAGAATTAGGTAGCGACTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-1071s21c1
Sequence:CCGGACAGTCGAATGGCCAACTATCCTCGAGGATAGTTGGCCATTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014914.3-1410s21c1
Sequence:CCGGGTGGGAGTTTAAGCGACTATTCTCGAGAATAGTCGCTTAAACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-3605s21c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-1238s1c1
Sequence:CCGGCCCAGAAGATTGTTGCCACAACTCGAGTTGTGGCAACAATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-1627s1c1
Sequence:CCGGCGAAGTGGCAAATCGTTGAATCTCGAGATTCAACGATTTGCCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-1628s1c1
Sequence:CCGGGAAGTGGCAAATCGTTGAATACTCGAGTATTCAACGATTTGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-3571s1c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-2925s1c1
Sequence:CCGGGAGAAACAATAACCGGAACAACTCGAGTTGTTCCGGTTATTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-2922s1c1
Sequence:CCGGCAGGAGAAACAATAACCGGAACTCGAGTTCCGGTTATTGTTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-717s1c1
Sequence:CCGGCATCGAAGATGCCTTCGTGAACTCGAGTTCACGAAGGCATCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-1692s1c1
Sequence:CCGGGCTGACCTATCATCCCAGTTTCTCGAGAAACTGGGATGATAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014914
VALIDATED
AGAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-1320s21c1
Sequence:CCGGCCTGCAAGTCGCTACCTAATTCTCGAGAATTAGGTAGCGACTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-1071s21c1
Sequence:CCGGACAGTCGAATGGCCAACTATCCTCGAGGATAGTTGGCCATTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014914.3-1410s21c1
Sequence:CCGGGTGGGAGTTTAAGCGACTATTCTCGAGAATAGTCGCTTAAACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-3605s21c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-1238s1c1
Sequence:CCGGCCCAGAAGATTGTTGCCACAACTCGAGTTGTGGCAACAATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-1627s1c1
Sequence:CCGGCGAAGTGGCAAATCGTTGAATCTCGAGATTCAACGATTTGCCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-1628s1c1
Sequence:CCGGGAAGTGGCAAATCGTTGAATACTCGAGTATTCAACGATTTGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-3571s1c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-2925s1c1
Sequence:CCGGGAGAAACAATAACCGGAACAACTCGAGTTGTTCCGGTTATTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-2922s1c1
Sequence:CCGGCAGGAGAAACAATAACCGGAACTCGAGTTCCGGTTATTGTTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-717s1c1
Sequence:CCGGCATCGAAGATGCCTTCGTGAACTCGAGTTCACGAAGGCATCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-1692s1c1
Sequence:CCGGGCTGACCTATCATCCCAGTTTCTCGAGAAACTGGGATGATAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014914
VALIDATED
AGAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-1320s21c1
Sequence:CCGGCCTGCAAGTCGCTACCTAATTCTCGAGAATTAGGTAGCGACTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-1071s21c1
Sequence:CCGGACAGTCGAATGGCCAACTATCCTCGAGGATAGTTGGCCATTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014914.3-1410s21c1
Sequence:CCGGGTGGGAGTTTAAGCGACTATTCTCGAGAATAGTCGCTTAAACTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014914.3-3605s21c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-1238s1c1
Sequence:CCGGCCCAGAAGATTGTTGCCACAACTCGAGTTGTGGCAACAATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-1627s1c1
Sequence:CCGGCGAAGTGGCAAATCGTTGAATCTCGAGATTCAACGATTTGCCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-1628s1c1
Sequence:CCGGGAAGTGGCAAATCGTTGAATACTCGAGTATTCAACGATTTGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-3571s1c1
Sequence:CCGGGCTGTTTAATAGAACGTGATTCTCGAGAATCACGTTCTATTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-2925s1c1
Sequence:CCGGGAGAAACAATAACCGGAACAACTCGAGTTGTTCCGGTTATTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-2922s1c1
Sequence:CCGGCAGGAGAAACAATAACCGGAACTCGAGTTCCGGTTATTGTTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014914.2-717s1c1
Sequence:CCGGCATCGAAGATGCCTTCGTGAACTCGAGTTCACGAAGGCATCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014914.2-1692s1c1
Sequence:CCGGGCTGACCTATCATCCCAGTTTCTCGAGAAACTGGGATGATAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks