EMAIL THIS PAGE TO A FRIEND

AGAP2

ArfGAP with GTPase domain, ankyrin repeat and PH domain 2

128 Gene Product Result for
Synonyms: CENTG1 GGAP2 PIKE
UniProtKB ID: Q99490, A8K9F7, O00578, Q548E0, Q8IWU3
Gene ID:
Human(116986) Summary: The protein encoded by this gene belongs to the centaurin gamma-like family. It mediates anti-apoptotic effects of nerve growth factor by activating nuclear phosphoinositide 3-kinase. It is overexpressed in cancer cells, and promotes cancer cell invasion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(216439) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Rat(65218) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Zebrafish(565109) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
domestic cat(101097254) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Horse(100050853) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
cow(504833) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
dog(481130) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
naked mole-rat(101702971) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
domestic guinea pig(100714700) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
sheep(101116895) ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122772 Rosetta Predictions human pricing
NM_014770 Rosetta Predictions human pricing
XM_001054911 Rosetta Predictions rat pricing
XM_576238 Rosetta Predictions rat pricing
NM_001033263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327335 predicted 2101
2 SASI_Hs02_00327336 predicted 2253
3 SASI_Hs02_00327337 predicted 1619
4 SASI_Hs02_00327338 predicted 2032
5 SASI_Hs02_00327339 predicted 2193
6 SASI_Hs02_00327340 predicted 2301
7 SASI_Hs02_00327341 predicted 1966
8 SASI_Hs02_00327342 predicted 1648
9 SASI_Hs02_00327343 predicted 2274
10 SASI_Hs02_00327344 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050934 predicted 1182
2 SASI_Hs01_00050935 predicted 1328
3 SASI_Hs02_00346259 predicted 702
4 SASI_Hs01_00050936 predicted 1109
5 SASI_Hs01_00050937 predicted 1272
6 SASI_Hs02_00346260 predicted 1387
7 SASI_Hs01_00050938 predicted 1048
8 SASI_Hs02_00346261 predicted 723
9 SASI_Hs01_00050941 predicted 1347
10 SASI_Hs02_00346262 predicted 489
11 SASI_Hs01_00050939 predicted 1457
12 SASI_Hs01_00050940 predicted 887
13 SASI_Hs01_00050942 predicted 1189
14 SASI_Hs01_00050943 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277682 predicted 1966
2 SASI_Rn02_00277683 predicted 3572
3 SASI_Rn02_00277684 predicted 2456
4 SASI_Rn02_00277685 predicted 4324
5 SASI_Rn02_00277686 predicted 3096
6 SASI_Rn02_00277687 predicted 3074
7 SASI_Rn02_00277688 predicted 1882
8 SASI_Rn02_00277689 predicted 3201
9 SASI_Rn02_00277690 predicted 1517
10 SASI_Rn02_00277691 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404917 predicted 253
2 SASI_Rn02_00404918 predicted 238
3 SASI_Rn02_00404919 predicted 241
4 SASI_Rn02_00404920 predicted 294
5 SASI_Rn02_00404921 predicted 246
6 SASI_Rn02_00404922 predicted 203
7 SASI_Rn02_00404923 predicted 214
8 SASI_Rn02_00404924 predicted 238
9 SASI_Rn02_00404925 predicted 233
10 SASI_Rn02_00404926 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182400 predicted 1533
2 SASI_Mm01_00182401 predicted 3558
3 SASI_Mm01_00182403 predicted 3062
4 SASI_Mm01_00182404 predicted 1962
5 SASI_Mm01_00182405 predicted 3563
6 SASI_Mm01_00182406 predicted 1884
7 SASI_Mm01_00182407 predicted 1278
8 SASI_Mm01_00182408 predicted 2457
9 SASI_Mm01_00182409 predicted 2013
10 SASI_Mm02_00288436 predicted 2299
11 SASI_Mm01_00182402 predicted 3104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014770
VALIDATED
AGAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1261s21c1
Sequence:CCGGTGCTGCGAACAACAGTCAAAGCTCGAGCTTTGACTGTTGTTCGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1138s21c1
Sequence:CCGGGTGGCAATTCCTTGAACAAAGCTCGAGCTTTGTTCAAGGAATTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-721s21c1
Sequence:CCGGGTGCAACCTATGGGCTCAATGCTCGAGCATTGAGCCCATAGGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-694s21c1
Sequence:CCGGTGAAACGCTGCAGCTACTATGCTCGAGCATAGTAGCTGCAGCGTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-336s21c1
Sequence:CCGGTCATCGCTCATCCACCGATTCCTCGAGGAATCGGTGGATGAGCGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1466s21c1
Sequence:CCGGGCTGAAGCCAGACCGGAATTTCTCGAGAAATTCCGGTCTGGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-391s21c1
Sequence:CCGGAGAGTGAGCAGTACAAGAAAGCTCGAGCTTTCTTGTACTGCTCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-270s21c1
Sequence:CCGGTGGACTTTGAGCCGCTCCATTCTCGAGAATGGAGCGGCTCAAAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1174s21c1
Sequence:CCGGATGTAACCCTGTCCAGTAATGCTCGAGCATTACTGGACAGGGTTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014770.2-2821s1c1
Sequence:CCGGCCATTGTTTCCACACTCGGATCTCGAGATCCGAGTGTGGAAACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-1051s1c1
Sequence:CCGGCCGAGAAACGAAGCTTGGATACTCGAGTATCCAAGCTTCGTTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-710s1c1
Sequence:CCGGCTATGAGACTTGTGCAACCTACTCGAGTAGGTTGCACAAGTCTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-1440s1c1
Sequence:CCGGCCACCAGATCAGACATCCAAACTCGAGTTTGGATGTCTGATCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014770.2-249s1c1
Sequence:CCGGGCTGTGATCAATAGCCAGGAACTCGAGTTCCTGGCTATTGATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014770
VALIDATED
AGAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1261s21c1
Sequence:CCGGTGCTGCGAACAACAGTCAAAGCTCGAGCTTTGACTGTTGTTCGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1138s21c1
Sequence:CCGGGTGGCAATTCCTTGAACAAAGCTCGAGCTTTGTTCAAGGAATTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-721s21c1
Sequence:CCGGGTGCAACCTATGGGCTCAATGCTCGAGCATTGAGCCCATAGGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-694s21c1
Sequence:CCGGTGAAACGCTGCAGCTACTATGCTCGAGCATAGTAGCTGCAGCGTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-336s21c1
Sequence:CCGGTCATCGCTCATCCACCGATTCCTCGAGGAATCGGTGGATGAGCGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1466s21c1
Sequence:CCGGGCTGAAGCCAGACCGGAATTTCTCGAGAAATTCCGGTCTGGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-391s21c1
Sequence:CCGGAGAGTGAGCAGTACAAGAAAGCTCGAGCTTTCTTGTACTGCTCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-270s21c1
Sequence:CCGGTGGACTTTGAGCCGCTCCATTCTCGAGAATGGAGCGGCTCAAAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1174s21c1
Sequence:CCGGATGTAACCCTGTCCAGTAATGCTCGAGCATTACTGGACAGGGTTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014770.2-2821s1c1
Sequence:CCGGCCATTGTTTCCACACTCGGATCTCGAGATCCGAGTGTGGAAACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-1051s1c1
Sequence:CCGGCCGAGAAACGAAGCTTGGATACTCGAGTATCCAAGCTTCGTTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-710s1c1
Sequence:CCGGCTATGAGACTTGTGCAACCTACTCGAGTAGGTTGCACAAGTCTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-1440s1c1
Sequence:CCGGCCACCAGATCAGACATCCAAACTCGAGTTTGGATGTCTGATCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014770.2-249s1c1
Sequence:CCGGGCTGTGATCAATAGCCAGGAACTCGAGTTCCTGGCTATTGATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014770
VALIDATED
AGAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1261s21c1
Sequence:CCGGTGCTGCGAACAACAGTCAAAGCTCGAGCTTTGACTGTTGTTCGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1138s21c1
Sequence:CCGGGTGGCAATTCCTTGAACAAAGCTCGAGCTTTGTTCAAGGAATTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-721s21c1
Sequence:CCGGGTGCAACCTATGGGCTCAATGCTCGAGCATTGAGCCCATAGGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-694s21c1
Sequence:CCGGTGAAACGCTGCAGCTACTATGCTCGAGCATAGTAGCTGCAGCGTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-336s21c1
Sequence:CCGGTCATCGCTCATCCACCGATTCCTCGAGGAATCGGTGGATGAGCGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1466s21c1
Sequence:CCGGGCTGAAGCCAGACCGGAATTTCTCGAGAAATTCCGGTCTGGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-391s21c1
Sequence:CCGGAGAGTGAGCAGTACAAGAAAGCTCGAGCTTTCTTGTACTGCTCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-270s21c1
Sequence:CCGGTGGACTTTGAGCCGCTCCATTCTCGAGAATGGAGCGGCTCAAAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014770.2-1174s21c1
Sequence:CCGGATGTAACCCTGTCCAGTAATGCTCGAGCATTACTGGACAGGGTTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014770.2-2821s1c1
Sequence:CCGGCCATTGTTTCCACACTCGGATCTCGAGATCCGAGTGTGGAAACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-1051s1c1
Sequence:CCGGCCGAGAAACGAAGCTTGGATACTCGAGTATCCAAGCTTCGTTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-710s1c1
Sequence:CCGGCTATGAGACTTGTGCAACCTACTCGAGTAGGTTGCACAAGTCTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014770.2-1440s1c1
Sequence:CCGGCCACCAGATCAGACATCCAAACTCGAGTTTGGATGTCTGATCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014770.2-249s1c1
Sequence:CCGGGCTGTGATCAATAGCCAGGAACTCGAGTTCCTGGCTATTGATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033263
AGAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-3085s21c1
Sequence:CCGGCTTGAAGCCAGACCGGAATTTCTCGAGAAATTCCGGTCTGGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-2880s21c1
Sequence:CCGGTGTTACGAACAACGGTCAAAGCTCGAGCTTTGACCGTTGTTCGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-1720s21c1
Sequence:CCGGCCGCAAGATGCTCAAGTTTATCTCGAGATAAACTTGAGCATCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-1889s21c1
Sequence:CCGGTGGACTTTGAGCCGATCAATTCTCGAGAATTGATCGGCTCAAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033263.4-5342s21c1
Sequence:CCGGGTAGTGGTTGGGAGGACTTTACTCGAGTAAAGTCCTCCCAACCACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033263
AGAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-3085s21c1
Sequence:CCGGCTTGAAGCCAGACCGGAATTTCTCGAGAAATTCCGGTCTGGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-2880s21c1
Sequence:CCGGTGTTACGAACAACGGTCAAAGCTCGAGCTTTGACCGTTGTTCGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-1720s21c1
Sequence:CCGGCCGCAAGATGCTCAAGTTTATCTCGAGATAAACTTGAGCATCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-1889s21c1
Sequence:CCGGTGGACTTTGAGCCGATCAATTCTCGAGAATTGATCGGCTCAAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033263.4-5342s21c1
Sequence:CCGGGTAGTGGTTGGGAGGACTTTACTCGAGTAAAGTCCTCCCAACCACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033263
AGAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-3085s21c1
Sequence:CCGGCTTGAAGCCAGACCGGAATTTCTCGAGAAATTCCGGTCTGGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-2880s21c1
Sequence:CCGGTGTTACGAACAACGGTCAAAGCTCGAGCTTTGACCGTTGTTCGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-1720s21c1
Sequence:CCGGCCGCAAGATGCTCAAGTTTATCTCGAGATAAACTTGAGCATCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033263.4-1889s21c1
Sequence:CCGGTGGACTTTGAGCCGATCAATTCTCGAGAATTGATCGGCTCAAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033263.4-5342s21c1
Sequence:CCGGGTAGTGGTTGGGAGGACTTTACTCGAGTAAAGTCCTCCCAACCACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)