EMAIL THIS PAGE TO A FRIEND

AGAP3

ArfGAP with GTPase domain, ankyrin repeat and PH domain 3

143 Gene Product Result for
Synonyms: AGAP-3 CENTG3 CRAG MRIP-1 cnt-g3
UniProtKB ID: Q96P47, Q59EN0, Q96RK3
Gene ID:
Mouse(213990) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Rat(362300) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
chicken(768507) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
cow(616302) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Horse(100064153) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
domestic cat(101082390) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
dog(100688009) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
sheep(101113584) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Domestic Rabbit(100351262) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
domestic guinea pig(100713648) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
naked mole-rat(101706435) ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042535 Rosetta Predictions human pricing
NM_031946 Rosetta Predictions human pricing
NM_001108616 Rosetta Predictions rat pricing
NM_139153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310418 predicted 365
2 SASI_Hs02_00310419 predicted 847
3 SASI_Hs02_00310420 predicted 480
4 SASI_Hs02_00310421 predicted 843
5 SASI_Hs02_00310422 predicted 809
6 SASI_Hs02_00310423 predicted 728
7 SASI_Hs02_00310424 predicted 801
8 SASI_Hs02_00310425 predicted 484
9 SASI_Hs02_00310426 predicted 723
10 SASI_Hs02_00310427 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359104 predicted 364
2 SASI_Hs02_00359105 predicted 846
3 SASI_Hs02_00359106 predicted 477
4 SASI_Hs02_00359107 predicted 841
5 SASI_Hs02_00359108 predicted 814
6 SASI_Hs01_00213311 predicted 729
7 SASI_Hs02_00359109 predicted 803
8 SASI_Hs02_00359110 predicted 478
9 SASI_Hs02_00359111 predicted 726
10 SASI_Hs02_00359112 predicted 701
11 SASI_Hs01_00213303 predicted 2769
12 SASI_Hs01_00213304 predicted 2829
13 SASI_Hs01_00213305 predicted 2510
14 SASI_Hs01_00213306 predicted 376
15 SASI_Hs01_00213307 predicted 2619
16 SASI_Hs01_00213308 predicted 2325
17 SASI_Hs01_00213309 predicted 2624
18 SASI_Hs01_00213310 predicted 2179
19 SASI_Hs01_00213312 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240389 predicted 1627
2 SASI_Rn02_00240390 predicted 2686
3 SASI_Rn02_00240391 predicted 2551
4 SASI_Rn02_00240392 predicted 3135
5 SASI_Rn02_00240393 predicted 2293
6 SASI_Rn02_00240394 predicted 1862
7 SASI_Rn02_00240395 predicted 1649
8 SASI_Rn02_00240396 predicted 3303
9 SASI_Rn02_00240397 predicted 2669
10 SASI_Rn02_00240398 predicted 3603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035008 predicted 1757
2 SASI_Mm02_00339917 predicted 1262
3 SASI_Mm01_00035009 predicted 470
4 SASI_Mm01_00035010 predicted 1131
5 SASI_Mm01_00035012 predicted 2630
6 SASI_Mm01_00035013 predicted 461
7 SASI_Mm01_00035014 predicted 2518
8 SASI_Mm01_00035015 predicted 2203
9 SASI_Mm01_00035016 predicted 414
10 SASI_Mm01_00035017 predicted 2363
11 SASI_Mm01_00035011 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139153
VALIDATED
AGAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139153.1-428s1c1
Sequence:CCGGGCAACCTGTCTAGTGGGAAATCTCGAGATTTCCCACTAGACAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139153.1-812s1c1
Sequence:CCGGCCTACTATGAAACATGCGCAACTCGAGTTGCGCATGTTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139153.1-2930s1c1
Sequence:CCGGCCATTAAAGGATAGAACCCTTCTCGAGAAGGGTTCTATCCTTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139153.1-1844s1c1
Sequence:CCGGCCTTTGAGTTTGTAGTGGTGTCTCGAGACACCACTACAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1318s21c1
Sequence:CCGGGACAACGGGTTGCTTACTTACCTCGAGGTAAGTAAGCAACCCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-2260s21c1
Sequence:CCGGGCTCTGGATGGTTACTCTAAGCTCGAGCTTAGAGTAACCATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1480s21c1
Sequence:CCGGTTGGCAATGGAGCGGAGTAACCTCGAGGTTACTCCGCTCCATTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-463s21c1
Sequence:CCGGCGATATCTGACAGGGACTTATCTCGAGATAAGTCCCTGTCAGATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1902s21c1
Sequence:CCGGAGCAGAAGAGCGGGAACTATGCTCGAGCATAGTTCCCGCTCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-268s21c1
Sequence:CCGGCCCAACATCTACGCCATCTACCTCGAGGTAGATGGCGTAGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-346s21c1
Sequence:CCGGATCTCCATCGAGGACTCATTTCTCGAGAAATGAGTCCTCGATGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-624s21c1
Sequence:CCGGGTTCAGCCTGGAGGATGAAATCTCGAGATTTCATCCTCCAGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139153
VALIDATED
AGAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139153.1-428s1c1
Sequence:CCGGGCAACCTGTCTAGTGGGAAATCTCGAGATTTCCCACTAGACAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139153.1-812s1c1
Sequence:CCGGCCTACTATGAAACATGCGCAACTCGAGTTGCGCATGTTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139153.1-2930s1c1
Sequence:CCGGCCATTAAAGGATAGAACCCTTCTCGAGAAGGGTTCTATCCTTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139153.1-1844s1c1
Sequence:CCGGCCTTTGAGTTTGTAGTGGTGTCTCGAGACACCACTACAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1318s21c1
Sequence:CCGGGACAACGGGTTGCTTACTTACCTCGAGGTAAGTAAGCAACCCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-2260s21c1
Sequence:CCGGGCTCTGGATGGTTACTCTAAGCTCGAGCTTAGAGTAACCATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1480s21c1
Sequence:CCGGTTGGCAATGGAGCGGAGTAACCTCGAGGTTACTCCGCTCCATTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-463s21c1
Sequence:CCGGCGATATCTGACAGGGACTTATCTCGAGATAAGTCCCTGTCAGATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1902s21c1
Sequence:CCGGAGCAGAAGAGCGGGAACTATGCTCGAGCATAGTTCCCGCTCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-268s21c1
Sequence:CCGGCCCAACATCTACGCCATCTACCTCGAGGTAGATGGCGTAGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-346s21c1
Sequence:CCGGATCTCCATCGAGGACTCATTTCTCGAGAAATGAGTCCTCGATGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-624s21c1
Sequence:CCGGGTTCAGCCTGGAGGATGAAATCTCGAGATTTCATCCTCCAGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139153
VALIDATED
AGAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139153.1-428s1c1
Sequence:CCGGGCAACCTGTCTAGTGGGAAATCTCGAGATTTCCCACTAGACAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139153.1-812s1c1
Sequence:CCGGCCTACTATGAAACATGCGCAACTCGAGTTGCGCATGTTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139153.1-2930s1c1
Sequence:CCGGCCATTAAAGGATAGAACCCTTCTCGAGAAGGGTTCTATCCTTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139153.1-1844s1c1
Sequence:CCGGCCTTTGAGTTTGTAGTGGTGTCTCGAGACACCACTACAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1318s21c1
Sequence:CCGGGACAACGGGTTGCTTACTTACCTCGAGGTAAGTAAGCAACCCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-2260s21c1
Sequence:CCGGGCTCTGGATGGTTACTCTAAGCTCGAGCTTAGAGTAACCATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1480s21c1
Sequence:CCGGTTGGCAATGGAGCGGAGTAACCTCGAGGTTACTCCGCTCCATTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-463s21c1
Sequence:CCGGCGATATCTGACAGGGACTTATCTCGAGATAAGTCCCTGTCAGATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-1902s21c1
Sequence:CCGGAGCAGAAGAGCGGGAACTATGCTCGAGCATAGTTCCCGCTCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-268s21c1
Sequence:CCGGCCCAACATCTACGCCATCTACCTCGAGGTAGATGGCGTAGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-346s21c1
Sequence:CCGGATCTCCATCGAGGACTCATTTCTCGAGAAATGAGTCCTCGATGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139153.2-624s21c1
Sequence:CCGGGTTCAGCCTGGAGGATGAAATCTCGAGATTTCATCCTCCAGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031946
AGAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-1215s1c1
Sequence:CCGGCCTGCATGATTACATGCAGAACTCGAGTTCTGCATGTAATCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-132s1c1
Sequence:CCGGGCATCCCAATATCTACGCCATCTCGAGATGGCGTAGATATTGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-1702s1c1
Sequence:CCGGGCAGAGGAGTCGTTTGAATTTCTCGAGAAATTCAAACGACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-2610s1c1
Sequence:CCGGCCGTAGTCCTAGCCTCCTATACTCGAGTATAGGAGGCTAGGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-2506s1c1
Sequence:CCGGGCAGACATCTTGATCCAGCATCTCGAGATGCTGGATCAAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-855s21c1
Sequence:CCGGGGTAGTGGCCTTGCGAAAGAACTCGAGTTCTTTCGCAAGGCCACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-2294s21c1
Sequence:CCGGGGATACGGGCCAAGTATGAACCTCGAGGTTCATACTTGGCCCGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031946.4-3055s21c1
Sequence:CCGGCACACGCCTTCATCCTGAAACCTCGAGGTTTCAGGATGAAGGCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-962s21c1
Sequence:CCGGACATCAACCAGGCCACGAATGCTCGAGCATTCGTGGCCTGGTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-776s21c1
Sequence:CCGGTGAAGCGGTGCACCTACTATGCTCGAGCATAGTAGGTGCACCGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-2493s21c1
Sequence:CCGGTGCCATGGCCAACGTTGTCTTCTCGAGAAGACAACGTTGGCCATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031946.4-2934s21c1
Sequence:CCGGGATTTAGCCCTCTGCCCTAAGCTCGAGCTTAGGGCAGAGGGCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-620s21c1
Sequence:CCCGTCAGTTTCCAGACGGTGTACACTCGAGTGTACACCGTCTGGAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-327s21c1
Sequence:CCGGCATCGAGGACTCGTTTGTGAACTCGAGTTCACAAACGAGTCCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-1367s21c1
Sequence:CCGGTGCTGCGGACAACGGTGAAAGCTCGAGCTTTCACCGTTGTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-382s21c1
Sequence:CCGGGAGCTTAAAGTGGGCATAGTGCTCGAGCACTATGCCCACTTTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031946
AGAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-1215s1c1
Sequence:CCGGCCTGCATGATTACATGCAGAACTCGAGTTCTGCATGTAATCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-132s1c1
Sequence:CCGGGCATCCCAATATCTACGCCATCTCGAGATGGCGTAGATATTGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-1702s1c1
Sequence:CCGGGCAGAGGAGTCGTTTGAATTTCTCGAGAAATTCAAACGACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-2610s1c1
Sequence:CCGGCCGTAGTCCTAGCCTCCTATACTCGAGTATAGGAGGCTAGGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-2506s1c1
Sequence:CCGGGCAGACATCTTGATCCAGCATCTCGAGATGCTGGATCAAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-855s21c1
Sequence:CCGGGGTAGTGGCCTTGCGAAAGAACTCGAGTTCTTTCGCAAGGCCACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-2294s21c1
Sequence:CCGGGGATACGGGCCAAGTATGAACCTCGAGGTTCATACTTGGCCCGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031946.4-3055s21c1
Sequence:CCGGCACACGCCTTCATCCTGAAACCTCGAGGTTTCAGGATGAAGGCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-962s21c1
Sequence:CCGGACATCAACCAGGCCACGAATGCTCGAGCATTCGTGGCCTGGTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-776s21c1
Sequence:CCGGTGAAGCGGTGCACCTACTATGCTCGAGCATAGTAGGTGCACCGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-2493s21c1
Sequence:CCGGTGCCATGGCCAACGTTGTCTTCTCGAGAAGACAACGTTGGCCATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031946.4-2934s21c1
Sequence:CCGGGATTTAGCCCTCTGCCCTAAGCTCGAGCTTAGGGCAGAGGGCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-620s21c1
Sequence:CCCGTCAGTTTCCAGACGGTGTACACTCGAGTGTACACCGTCTGGAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-327s21c1
Sequence:CCGGCATCGAGGACTCGTTTGTGAACTCGAGTTCACAAACGAGTCCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-1367s21c1
Sequence:CCGGTGCTGCGGACAACGGTGAAAGCTCGAGCTTTCACCGTTGTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-382s21c1
Sequence:CCGGGAGCTTAAAGTGGGCATAGTGCTCGAGCACTATGCCCACTTTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031946
AGAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-1215s1c1
Sequence:CCGGCCTGCATGATTACATGCAGAACTCGAGTTCTGCATGTAATCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-132s1c1
Sequence:CCGGGCATCCCAATATCTACGCCATCTCGAGATGGCGTAGATATTGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-1702s1c1
Sequence:CCGGGCAGAGGAGTCGTTTGAATTTCTCGAGAAATTCAAACGACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-2610s1c1
Sequence:CCGGCCGTAGTCCTAGCCTCCTATACTCGAGTATAGGAGGCTAGGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031946.3-2506s1c1
Sequence:CCGGGCAGACATCTTGATCCAGCATCTCGAGATGCTGGATCAAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-855s21c1
Sequence:CCGGGGTAGTGGCCTTGCGAAAGAACTCGAGTTCTTTCGCAAGGCCACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-2294s21c1
Sequence:CCGGGGATACGGGCCAAGTATGAACCTCGAGGTTCATACTTGGCCCGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031946.4-3055s21c1
Sequence:CCGGCACACGCCTTCATCCTGAAACCTCGAGGTTTCAGGATGAAGGCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-962s21c1
Sequence:CCGGACATCAACCAGGCCACGAATGCTCGAGCATTCGTGGCCTGGTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-776s21c1
Sequence:CCGGTGAAGCGGTGCACCTACTATGCTCGAGCATAGTAGGTGCACCGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-2493s21c1
Sequence:CCGGTGCCATGGCCAACGTTGTCTTCTCGAGAAGACAACGTTGGCCATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031946.4-2934s21c1
Sequence:CCGGGATTTAGCCCTCTGCCCTAAGCTCGAGCTTAGGGCAGAGGGCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-620s21c1
Sequence:CCCGTCAGTTTCCAGACGGTGTACACTCGAGTGTACACCGTCTGGAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-327s21c1
Sequence:CCGGCATCGAGGACTCGTTTGTGAACTCGAGTTCACAAACGAGTCCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-1367s21c1
Sequence:CCGGTGCTGCGGACAACGGTGAAAGCTCGAGCTTTCACCGTTGTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031946.4-382s21c1
Sequence:CCGGGAGCTTAAAGTGGGCATAGTGCTCGAGCACTATGCCCACTTTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks