EMAIL THIS PAGE TO A FRIEND

AGAP4

ArfGAP with GTPase domain, ankyrin repeat and PH domain 4

Synonyms: AGAP-4 CTGLF1 MRIP2
Species: Human AGAP4(119016)
UniProtKB ID: Q96P64
Gene ID:
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133446 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363119 predicted 1638
2 SASI_Hs01_00213373 predicted 432
3 SASI_Hs02_00363120 predicted 634
4 SASI_Hs01_00213374 predicted 414
5 SASI_Hs02_00363121 predicted 477
6 SASI_Hs02_00363122 predicted 1388
7 SASI_Hs02_00363123 predicted 1510
8 SASI_Hs01_00213375 predicted 448
9 SASI_Hs01_00213376 predicted 432
10 SASI_Hs01_00213377 predicted 400
11 SASI_Hs01_00213378 predicted 429
12 SASI_Hs01_00213379 predicted 201
13 SASI_Hs01_00213380 predicted 391
14 SASI_Hs01_00213381 predicted 640
15 SASI_Hs01_00213382 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133446
AGAP4 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-1758s1c1
Sequence:CCGGCCGTTCCAAATATGAGGAGAACTCGAGTTCTCCTCATATTTGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-809s1c1
Sequence:CCGGCCAACCTGTTTACATCTGAGACTCGAGTCTCAGATGTAAACAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-450s1c1
Sequence:CCGGCCATGTATCTACTGTGCGTTTCTCGAGAAACGCACAGTAGATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-584s1c1
Sequence:CCGGCACAAAGAGATGCAGATAGATCTCGAGATCTATCTGCATCTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1641s1c1
Sequence:CCGGCAGGAAGGTTATGTCATCTATCTCGAGATAGATGACATAACCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-342s1c1
Sequence:CCGGGCCTGAAGCTTTGGAGTTTAACTCGAGTTAAACTCCAAAGCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1234s1c1
Sequence:CCGGCCCTCTCCTCATGCTAATAAACTCGAGTTTATTAGCATGAGGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-560s1c1
Sequence:CCGGCCTTGGAGATACCTCATCATACTCGAGTATGATGAGGTATCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-1053s1c1
Sequence:CCGGCCTTCAGACATCTACCATCAACTCGAGTTGATGGTAGATGTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1512s1c1
Sequence:CCGGGAATCCTAAGTGGGCCAGTTTCTCGAGAAACTGGCCCACTTAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133446
AGAP4 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-1758s1c1
Sequence:CCGGCCGTTCCAAATATGAGGAGAACTCGAGTTCTCCTCATATTTGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-809s1c1
Sequence:CCGGCCAACCTGTTTACATCTGAGACTCGAGTCTCAGATGTAAACAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-450s1c1
Sequence:CCGGCCATGTATCTACTGTGCGTTTCTCGAGAAACGCACAGTAGATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-584s1c1
Sequence:CCGGCACAAAGAGATGCAGATAGATCTCGAGATCTATCTGCATCTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1641s1c1
Sequence:CCGGCAGGAAGGTTATGTCATCTATCTCGAGATAGATGACATAACCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-342s1c1
Sequence:CCGGGCCTGAAGCTTTGGAGTTTAACTCGAGTTAAACTCCAAAGCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1234s1c1
Sequence:CCGGCCCTCTCCTCATGCTAATAAACTCGAGTTTATTAGCATGAGGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-560s1c1
Sequence:CCGGCCTTGGAGATACCTCATCATACTCGAGTATGATGAGGTATCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-1053s1c1
Sequence:CCGGCCTTCAGACATCTACCATCAACTCGAGTTGATGGTAGATGTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1512s1c1
Sequence:CCGGGAATCCTAAGTGGGCCAGTTTCTCGAGAAACTGGCCCACTTAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133446
AGAP4 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-1758s1c1
Sequence:CCGGCCGTTCCAAATATGAGGAGAACTCGAGTTCTCCTCATATTTGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-809s1c1
Sequence:CCGGCCAACCTGTTTACATCTGAGACTCGAGTCTCAGATGTAAACAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-450s1c1
Sequence:CCGGCCATGTATCTACTGTGCGTTTCTCGAGAAACGCACAGTAGATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-584s1c1
Sequence:CCGGCACAAAGAGATGCAGATAGATCTCGAGATCTATCTGCATCTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1641s1c1
Sequence:CCGGCAGGAAGGTTATGTCATCTATCTCGAGATAGATGACATAACCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-342s1c1
Sequence:CCGGGCCTGAAGCTTTGGAGTTTAACTCGAGTTAAACTCCAAAGCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1234s1c1
Sequence:CCGGCCCTCTCCTCATGCTAATAAACTCGAGTTTATTAGCATGAGGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-560s1c1
Sequence:CCGGCCTTGGAGATACCTCATCATACTCGAGTATGATGAGGTATCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133446.1-1053s1c1
Sequence:CCGGCCTTCAGACATCTACCATCAACTCGAGTTGATGGTAGATGTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133446.1-1512s1c1
Sequence:CCGGGAATCCTAAGTGGGCCAGTTTCTCGAGAAACTGGCCCACTTAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks