EMAIL THIS PAGE TO A FRIEND

AGAP8

ArfGAP with GTPase domain, ankyrin repeat and PH domain 8

46 Gene Product Result for
Synonyms: AGAP-8 CTGLF5
Species: Human AGAP8(728404)
UniProtKB ID: Q5SRD3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301800 ANTI-AGAP8/AGAP5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077686 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077686 Rosetta Predictions human pricing
XM_001719596 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313107 predicted 431
2 SASI_Hs02_00313108 predicted 410
3 SASI_Hs02_00313109 predicted 446
4 SASI_Hs02_00313110 predicted 433
5 SASI_Hs02_00313111 predicted 402
6 SASI_Hs02_00313112 predicted 414
7 SASI_Hs02_00313113 predicted 377
8 SASI_Hs02_00313114 predicted 363
9 SASI_Hs02_00313115 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00431384 predicted 791
2 SASI_Hs02_00431385 predicted 617
3 SASI_Hs02_00431386 predicted 823
4 SASI_Hs02_00431387 predicted 732
5 SASI_Hs02_00431388 predicted 774
6 SASI_Hs02_00431389 predicted 508
7 SASI_Hs02_00431390 predicted 757
8 SASI_Hs02_00431391 predicted 824
9 SASI_Hs02_00431392 predicted 756
10 SASI_Hs02_00431393 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077686
AGAP8 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-1321s21c1
Sequence:CCGGCACTTTGAAGCCACGACATATCTCGAGATATGTCGTGGCTTCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-986s21c1
Sequence:CCGGATGGCGTGCTCACCTATTATTCTCGAGAATAATAGGTGAGCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-562s21c1
Sequence:CCGGTTGGAGATACCTCATCATATCCTCGAGGATATGATGAGGTATCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077686.1-2197s21c1
Sequence:CCGGGAAATCACAAATTCAGCTAATCTCGAGATTAGCTGAATTTGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077686
AGAP8 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-1321s21c1
Sequence:CCGGCACTTTGAAGCCACGACATATCTCGAGATATGTCGTGGCTTCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-986s21c1
Sequence:CCGGATGGCGTGCTCACCTATTATTCTCGAGAATAATAGGTGAGCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-562s21c1
Sequence:CCGGTTGGAGATACCTCATCATATCCTCGAGGATATGATGAGGTATCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077686.1-2197s21c1
Sequence:CCGGGAAATCACAAATTCAGCTAATCTCGAGATTAGCTGAATTTGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077686
AGAP8 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-1321s21c1
Sequence:CCGGCACTTTGAAGCCACGACATATCTCGAGATATGTCGTGGCTTCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-986s21c1
Sequence:CCGGATGGCGTGCTCACCTATTATTCTCGAGAATAATAGGTGAGCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077686.1-562s21c1
Sequence:CCGGTTGGAGATACCTCATCATATCCTCGAGGATATGATGAGGTATCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077686.1-2197s21c1
Sequence:CCGGGAAATCACAAATTCAGCTAATCTCGAGATTAGCTGAATTTGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks