EMAIL THIS PAGE TO A FRIEND

AGBL2

ATP/GTP binding protein-like 2

105 Gene Product Result for
UniProtKB ID: Q5U5Z8, A8MPX2, Q53FV5, Q8IV57, Q9H5C0
Gene ID:
Mouse(271813) ATP/GTP binding protein-like 2
Rat(366124) ATP/GTP binding protein-like 2
chicken(426630) ATP/GTP binding protein-like 2
cow(504739) ATP/GTP binding protein-like 2
cow(100848075) ATP/GTP binding protein-like 2
Horse(100051805) ATP/GTP binding protein-like 2
domestic cat(101097668) ATP/GTP binding protein-like 2
dog(100685701) ATP/GTP binding protein-like 2
sheep(101120523) ATP/GTP binding protein-like 2
domestic guinea pig(100729054) ATP/GTP binding protein-like 2
naked mole-rat(101697129) ATP/GTP binding protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024783 Rosetta Predictions human pricing
XM_001077842 Rosetta Predictions rat pricing
XM_345401 Rosetta Predictions rat pricing
NM_178755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036166 predicted 760
2 SASI_Hs01_00036168 predicted 1056
3 SASI_Hs01_00036169 predicted 1110
4 SASI_Hs01_00036170 predicted 941
5 SASI_Hs02_00357321 predicted 1042
6 SASI_Hs01_00036171 predicted 1799
7 SASI_Hs01_00036173 predicted 1103
8 SASI_Hs02_00357322 predicted 1651
9 SASI_Hs01_00036174 predicted 2894
10 SASI_Hs02_00357323 predicted 1773
11 SASI_Hs01_00036167 predicted 1287
12 SASI_Hs01_00036172 predicted 2882
13 SASI_Hs01_00036175 predicted 2658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358742 predicted 345
2 SASI_Rn02_00358743 predicted 1049
3 SASI_Rn02_00358744 predicted 311
4 SASI_Rn02_00358745 predicted 1818
5 SASI_Rn02_00358746 predicted 636
6 SASI_Rn02_00358747 predicted 669
7 SASI_Rn02_00358748 predicted 579
8 SASI_Rn02_00358749 predicted 587
9 SASI_Rn02_00358750 predicted 888
10 SASI_Rn02_00358751 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398317 predicted 340
2 SASI_Rn02_00398318 predicted 418
3 SASI_Rn02_00398319 predicted 1040
4 SASI_Rn02_00398320 predicted 310
5 SASI_Rn02_00398321 predicted 634
6 SASI_Rn02_00398322 predicted 668
7 SASI_Rn02_00398323 predicted 1119
8 SASI_Rn02_00398324 predicted 573
9 SASI_Rn02_00398325 predicted 590
10 SASI_Rn02_00398326 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137044 predicted 2475
2 SASI_Mm02_00349298 predicted 2562
3 SASI_Mm01_00137045 predicted 1232
4 SASI_Mm01_00137046 predicted 1930
5 SASI_Mm01_00137047 predicted 1819
6 SASI_Mm01_00137050 predicted 586
7 SASI_Mm01_00137051 predicted 575
8 SASI_Mm01_00137052 predicted 423
9 SASI_Mm01_00137053 predicted 2240
10 SASI_Mm02_00349299 predicted 2295
11 SASI_Mm01_00137048 predicted 2769
12 SASI_Mm01_00137049 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178755
AGBL2 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-915s1c1
Sequence:CCGGGCCGTCAGAGTAGGTATCTATCTCGAGATAGATACCTACTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-620s1c1
Sequence:CCGGGCCAATCGAATGTGAGGTCATCTCGAGATGACCTCACATTCGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-2578s1c1
Sequence:CCGGGCCCTAAGAATAAAGAAAGAACTCGAGTTCTTTCTTTATTCTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-1265s1c1
Sequence:CCGGCCCATACACTTATACTGACTTCTCGAGAAGTCAGTATAAGTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-2388s1c1
Sequence:CCGGCGGGAGTTAAAGTTAACAGAACTCGAGTTCTGTTAACTTTAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178755
AGBL2 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-915s1c1
Sequence:CCGGGCCGTCAGAGTAGGTATCTATCTCGAGATAGATACCTACTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-620s1c1
Sequence:CCGGGCCAATCGAATGTGAGGTCATCTCGAGATGACCTCACATTCGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-2578s1c1
Sequence:CCGGGCCCTAAGAATAAAGAAAGAACTCGAGTTCTTTCTTTATTCTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-1265s1c1
Sequence:CCGGCCCATACACTTATACTGACTTCTCGAGAAGTCAGTATAAGTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-2388s1c1
Sequence:CCGGCGGGAGTTAAAGTTAACAGAACTCGAGTTCTGTTAACTTTAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178755
AGBL2 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-915s1c1
Sequence:CCGGGCCGTCAGAGTAGGTATCTATCTCGAGATAGATACCTACTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-620s1c1
Sequence:CCGGGCCAATCGAATGTGAGGTCATCTCGAGATGACCTCACATTCGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-2578s1c1
Sequence:CCGGGCCCTAAGAATAAAGAAAGAACTCGAGTTCTTTCTTTATTCTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-1265s1c1
Sequence:CCGGCCCATACACTTATACTGACTTCTCGAGAAGTCAGTATAAGTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178755.1-2388s1c1
Sequence:CCGGCGGGAGTTAAAGTTAACAGAACTCGAGTTCTGTTAACTTTAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024783
AGBL2 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024783.2-3087s1c1
Sequence:CCGGGCAGCACAGATATACCTCATTCTCGAGAATGAGGTATATCTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-1288s1c1
Sequence:CCGGCCCATATACATACACTGATTTCTCGAGAAATCAGTGTATGTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-140s1c1
Sequence:CCGGCCTGATCCTTATGAAGACTTTCTCGAGAAAGTCTTCATAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-2533s1c1
Sequence:CCGGCCCAAGGTTAAATGAGACAAACTCGAGTTTGTCTCATTTAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-1383s1c1
Sequence:CCGGGCCTAGCAGGAAATACCGTTTCTCGAGAAACGGTATTTCCTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-2364s21c1
Sequence:CCGGAGACTAGGAAACAGCGAAATGCTCGAGCATTTCGCTGTTTCCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-1954s21c1
Sequence:CCGGGTGGCGGATGGGAATCCTAAACTCGAGTTTAGGATTCCCATCCGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-326s21c1
Sequence:CCGGCTTCTATGGCCTATCAGTTTACTCGAGTAAACTGATAGGCCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024783
AGBL2 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024783.2-3087s1c1
Sequence:CCGGGCAGCACAGATATACCTCATTCTCGAGAATGAGGTATATCTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-1288s1c1
Sequence:CCGGCCCATATACATACACTGATTTCTCGAGAAATCAGTGTATGTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-140s1c1
Sequence:CCGGCCTGATCCTTATGAAGACTTTCTCGAGAAAGTCTTCATAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-2533s1c1
Sequence:CCGGCCCAAGGTTAAATGAGACAAACTCGAGTTTGTCTCATTTAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-1383s1c1
Sequence:CCGGGCCTAGCAGGAAATACCGTTTCTCGAGAAACGGTATTTCCTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-2364s21c1
Sequence:CCGGAGACTAGGAAACAGCGAAATGCTCGAGCATTTCGCTGTTTCCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-1954s21c1
Sequence:CCGGGTGGCGGATGGGAATCCTAAACTCGAGTTTAGGATTCCCATCCGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-326s21c1
Sequence:CCGGCTTCTATGGCCTATCAGTTTACTCGAGTAAACTGATAGGCCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024783
AGBL2 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024783.2-3087s1c1
Sequence:CCGGGCAGCACAGATATACCTCATTCTCGAGAATGAGGTATATCTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-1288s1c1
Sequence:CCGGCCCATATACATACACTGATTTCTCGAGAAATCAGTGTATGTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-140s1c1
Sequence:CCGGCCTGATCCTTATGAAGACTTTCTCGAGAAAGTCTTCATAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-2533s1c1
Sequence:CCGGCCCAAGGTTAAATGAGACAAACTCGAGTTTGTCTCATTTAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024783.2-1383s1c1
Sequence:CCGGGCCTAGCAGGAAATACCGTTTCTCGAGAAACGGTATTTCCTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-2364s21c1
Sequence:CCGGAGACTAGGAAACAGCGAAATGCTCGAGCATTTCGCTGTTTCCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-1954s21c1
Sequence:CCGGGTGGCGGATGGGAATCCTAAACTCGAGTTTAGGATTCCCATCCGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024783.2-326s21c1
Sequence:CCGGCTTCTATGGCCTATCAGTTTACTCGAGTAAACTGATAGGCCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks