EMAIL THIS PAGE TO A FRIEND

AGBL3

ATP/GTP binding protein-like 3

151 Gene Product Result for
UniProtKB ID: Q8NEM8, B7Z827, Q9H965
Gene ID:
Mouse(76223) ATP/GTP binding protein-like 3
Rat(500076) ATP/GTP binding protein-like 3
domestic guinea pig(100724682) ATP/GTP binding protein-like 3
sheep(101121595) ATP/GTP binding protein-like 3
Domestic Rabbit(100342034) ATP/GTP binding protein-like 3
chicken(769745) ATP/GTP binding protein-like 3
domestic cat(101098368) ATP/GTP binding protein-like 3
cow(527479) ATP/GTP binding protein-like 3
dog(475504) ATP/GTP binding protein-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005431 MISSION® esiRNA esiRNA targeting mouse Agbl3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178563 Rosetta Predictions human pricing
XM_001723112 Rosetta Predictions human pricing
XM_001723784 Rosetta Predictions human pricing
XM_001726535 Rosetta Predictions human pricing
XM_001726650 Rosetta Predictions human pricing
XM_001067608 Rosetta Predictions rat pricing
XM_575426 Rosetta Predictions rat pricing
NM_178630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171149 predicted 1839
2 SASI_Hs01_00171150 predicted 1103
3 SASI_Hs01_00171151 predicted 917
4 SASI_Hs01_00171152 predicted 311
5 SASI_Hs01_00171153 predicted 710
6 SASI_Hs01_00171154 predicted 782
7 SASI_Hs01_00171155 predicted 1040
8 SASI_Hs01_00171156 predicted 1738
9 SASI_Hs01_00171157 predicted 1474
10 SASI_Hs01_00171158 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00453320 predicted 1849
2 SASI_Hs02_00453321 predicted 1113
3 SASI_Hs02_00453322 predicted 1577
4 SASI_Hs02_00453323 predicted 910
5 SASI_Hs02_00453324 predicted 310
6 SASI_Hs02_00453325 predicted 713
7 SASI_Hs02_00453326 predicted 787
8 SASI_Hs02_00453327 predicted 1040
9 SASI_Hs02_00453328 predicted 1748
10 SASI_Hs02_00453329 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457573 predicted 1851
2 SASI_Hs02_00457574 predicted 1113
3 SASI_Hs02_00457575 predicted 1576
4 SASI_Hs02_00457576 predicted 918
5 SASI_Hs02_00457577 predicted 309
6 SASI_Hs02_00457578 predicted 715
7 SASI_Hs02_00457579 predicted 780
8 SASI_Hs02_00457580 predicted 1046
9 SASI_Hs02_00457581 predicted 1742
10 SASI_Hs02_00457582 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00474860 predicted 1850
2 SASI_Hs02_00474861 predicted 1111
3 SASI_Hs02_00474862 predicted 1577
4 SASI_Hs02_00474863 predicted 918
5 SASI_Hs02_00474864 predicted 306
6 SASI_Hs02_00474865 predicted 716
7 SASI_Hs02_00474866 predicted 787
8 SASI_Hs02_00474867 predicted 1039
9 SASI_Hs02_00474868 predicted 1742
10 SASI_Hs02_00474869 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00475577 predicted 1846
2 SASI_Hs02_00475578 predicted 1105
3 SASI_Hs02_00475579 predicted 1579
4 SASI_Hs02_00475580 predicted 914
5 SASI_Hs02_00475581 predicted 306
6 SASI_Hs02_00475582 predicted 718
7 SASI_Hs02_00475583 predicted 785
8 SASI_Hs02_00475584 predicted 1047
9 SASI_Hs02_00475585 predicted 1747
10 SASI_Hs02_00475586 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321569 predicted 1960
2 SASI_Rn02_00321570 predicted 2067
3 SASI_Rn02_00321571 predicted 405
4 SASI_Rn02_00321572 predicted 1327
5 SASI_Rn02_00321573 predicted 2482
6 SASI_Rn02_00321574 predicted 2599
7 SASI_Rn02_00321575 predicted 1259
8 SASI_Rn02_00321576 predicted 1624
9 SASI_Rn02_00321577 predicted 573
10 SASI_Rn02_00321578 predicted 2547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403656 predicted 2696
2 SASI_Rn02_00403657 predicted 1983
3 SASI_Rn02_00403658 predicted 1959
4 SASI_Rn02_00403659 predicted 2068
5 SASI_Rn02_00403660 predicted 1333
6 SASI_Rn02_00403661 predicted 2490
7 SASI_Rn02_00403662 predicted 2599
8 SASI_Rn02_00403663 predicted 1626
9 SASI_Rn02_00403664 predicted 2032
10 SASI_Rn02_00403665 predicted 2550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176500 predicted 2024
2 SASI_Mm01_00176501 predicted 1999
3 SASI_Mm02_00348995 predicted 2857
4 SASI_Mm01_00176502 predicted 1883
5 SASI_Mm02_00348996 predicted 2296
6 SASI_Mm02_00348997 predicted 3214
7 SASI_Mm02_00348998 predicted 2462
8 SASI_Mm01_00176505 predicted 1044
9 SASI_Mm02_00348999 predicted 3261
10 SASI_Mm01_00176506 predicted 1923
11 SASI_Mm01_00176503 predicted 738
12 SASI_Mm01_00176504 predicted 1559
13 SASI_Mm01_00176507 predicted 628
14 SASI_Mm01_00176508 predicted 379
15 SASI_Mm01_00176509 predicted 1475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178563
AGBL3 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178563.3-2972s21c1
Sequence:CCGGGATGGACAACCCACCTTATATCTCGAGATATAAGGTGGGTTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178563.3-1509s21c1
Sequence:CCGGGACGGGATTTAAACCGTAATTCTCGAGAATTACGGTTTAAATCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178563.1-2417s1c1
Sequence:CCGGCCAGATGATTATATGGTTGATCTCGAGATCAACCATATAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-1683s1c1
Sequence:CCGGGCAACGAATCTTCCCACTTATCTCGAGATAAGTGGGAAGATTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-721s1c1
Sequence:CCGGCGTGACAATACTTTGATGTTTCTCGAGAAACATCAAAGTATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-380s1c1
Sequence:CCGGCCCGGACTACACAGATACTATCTCGAGATAGTATCTGTGTAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-709s1c1
Sequence:CCGGCCTGTGGATTACCGTGACAATCTCGAGATTGTCACGGTAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178563
AGBL3 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178563.3-2972s21c1
Sequence:CCGGGATGGACAACCCACCTTATATCTCGAGATATAAGGTGGGTTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178563.3-1509s21c1
Sequence:CCGGGACGGGATTTAAACCGTAATTCTCGAGAATTACGGTTTAAATCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178563.1-2417s1c1
Sequence:CCGGCCAGATGATTATATGGTTGATCTCGAGATCAACCATATAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-1683s1c1
Sequence:CCGGGCAACGAATCTTCCCACTTATCTCGAGATAAGTGGGAAGATTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-721s1c1
Sequence:CCGGCGTGACAATACTTTGATGTTTCTCGAGAAACATCAAAGTATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-380s1c1
Sequence:CCGGCCCGGACTACACAGATACTATCTCGAGATAGTATCTGTGTAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-709s1c1
Sequence:CCGGCCTGTGGATTACCGTGACAATCTCGAGATTGTCACGGTAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178563
AGBL3 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178563.3-2972s21c1
Sequence:CCGGGATGGACAACCCACCTTATATCTCGAGATATAAGGTGGGTTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178563.3-1509s21c1
Sequence:CCGGGACGGGATTTAAACCGTAATTCTCGAGAATTACGGTTTAAATCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178563.1-2417s1c1
Sequence:CCGGCCAGATGATTATATGGTTGATCTCGAGATCAACCATATAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-1683s1c1
Sequence:CCGGGCAACGAATCTTCCCACTTATCTCGAGATAAGTGGGAAGATTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-721s1c1
Sequence:CCGGCGTGACAATACTTTGATGTTTCTCGAGAAACATCAAAGTATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-380s1c1
Sequence:CCGGCCCGGACTACACAGATACTATCTCGAGATAGTATCTGTGTAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178563.1-709s1c1
Sequence:CCGGCCTGTGGATTACCGTGACAATCTCGAGATTGTCACGGTAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178630
VALIDATED
AGBL3 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1938s21c1
Sequence:CCGGACGGGATTTAAACCGTAATTACTCGAGTAATTACGGTTTAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1803s21c1
Sequence:CCGGGAAAGGCTTCCTGGATTATATCTCGAGATATAATCCAGGAAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1293s21c1
Sequence:CCGGGCACACTCAGTGGTACTATTTCTCGAGAAATAGTACCACTGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-2064s21c1
Sequence:CCGGCCATAGTAGGAAACAGAATATCTCGAGATATTCTGTTTCCTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1037s21c1
Sequence:CCGGGCCTGGAAATAGAGCCTGTTTCTCGAGAAACAGGCTCTATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178630.2-759s1c1
Sequence:CCGGGCAAGGTTTGAGAGTGGTAATCTCGAGATTACCACTCTCAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-595s1c1
Sequence:CCGGGCCTGGAAATAGAGCCTGTTTCTCGAGAAACAGGCTCTATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-1622s1c1
Sequence:CCGGCCATAGTAGGAAACAGAATATCTCGAGATATTCTGTTTCCTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178630.2-2622s1c1
Sequence:CCGGCCACTCTACATTTAACCATATCTCGAGATATGGTTAAATGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-1140s1c1
Sequence:CCGGCCATACACTTACTCCAACCTTCTCGAGAAGGTTGGAGTAAGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178630
VALIDATED
AGBL3 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1938s21c1
Sequence:CCGGACGGGATTTAAACCGTAATTACTCGAGTAATTACGGTTTAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1803s21c1
Sequence:CCGGGAAAGGCTTCCTGGATTATATCTCGAGATATAATCCAGGAAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1293s21c1
Sequence:CCGGGCACACTCAGTGGTACTATTTCTCGAGAAATAGTACCACTGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-2064s21c1
Sequence:CCGGCCATAGTAGGAAACAGAATATCTCGAGATATTCTGTTTCCTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1037s21c1
Sequence:CCGGGCCTGGAAATAGAGCCTGTTTCTCGAGAAACAGGCTCTATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178630.2-759s1c1
Sequence:CCGGGCAAGGTTTGAGAGTGGTAATCTCGAGATTACCACTCTCAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-595s1c1
Sequence:CCGGGCCTGGAAATAGAGCCTGTTTCTCGAGAAACAGGCTCTATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-1622s1c1
Sequence:CCGGCCATAGTAGGAAACAGAATATCTCGAGATATTCTGTTTCCTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178630.2-2622s1c1
Sequence:CCGGCCACTCTACATTTAACCATATCTCGAGATATGGTTAAATGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-1140s1c1
Sequence:CCGGCCATACACTTACTCCAACCTTCTCGAGAAGGTTGGAGTAAGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178630
VALIDATED
AGBL3 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1938s21c1
Sequence:CCGGACGGGATTTAAACCGTAATTACTCGAGTAATTACGGTTTAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1803s21c1
Sequence:CCGGGAAAGGCTTCCTGGATTATATCTCGAGATATAATCCAGGAAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1293s21c1
Sequence:CCGGGCACACTCAGTGGTACTATTTCTCGAGAAATAGTACCACTGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-2064s21c1
Sequence:CCGGCCATAGTAGGAAACAGAATATCTCGAGATATTCTGTTTCCTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178630.3-1037s21c1
Sequence:CCGGGCCTGGAAATAGAGCCTGTTTCTCGAGAAACAGGCTCTATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178630.2-759s1c1
Sequence:CCGGGCAAGGTTTGAGAGTGGTAATCTCGAGATTACCACTCTCAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-595s1c1
Sequence:CCGGGCCTGGAAATAGAGCCTGTTTCTCGAGAAACAGGCTCTATTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-1622s1c1
Sequence:CCGGCCATAGTAGGAAACAGAATATCTCGAGATATTCTGTTTCCTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178630.2-2622s1c1
Sequence:CCGGCCACTCTACATTTAACCATATCTCGAGATATGGTTAAATGTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178630.2-1140s1c1
Sequence:CCGGCCATACACTTACTCCAACCTTCTCGAGAAGGTTGGAGTAAGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks