EMAIL THIS PAGE TO A FRIEND

AGBL4

ATP/GTP binding protein-like 4

82 Gene Product Result for
Synonyms: CCP6
UniProtKB ID: Q5VU57, B3KT26, B4DG37
Gene ID:
Mouse(78933) ATP/GTP binding protein-like 4
Rat(362562) ATP/GTP binding protein-like 4
Zebrafish(550450) ATP/GTP binding protein-like 4
cow(615787) ATP/GTP binding protein-like 4
Horse(100063327) ATP/GTP binding protein-like 4
domestic cat(101084558) ATP/GTP binding protein-like 4
dog(610123) ATP/GTP binding protein-like 4
chicken(772083) ATP/GTP binding protein-like 4
sheep(101115174) ATP/GTP binding protein-like 4
domestic guinea pig(100726525) ATP/GTP binding protein-like 4
naked mole-rat(101710436) ATP/GTP binding protein-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001048189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005631 MISSION® esiRNA esiRNA targeting human AGBL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032785 Rosetta Predictions human pricing
NM_001100981 Rosetta Predictions rat pricing
NM_001048189 Rosetta Predictions mouse pricing
NM_030231 Rosetta Predictions mouse pricing
XM_980062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065090 predicted 672
2 SASI_Hs01_00065091 predicted 658
3 SASI_Hs01_00065092 predicted 311
4 SASI_Hs01_00065095 predicted 666
5 SASI_Hs02_00360339 predicted 637
6 SASI_Hs01_00065098 predicted 286
7 SASI_Hs01_00065099 predicted 507
8 SASI_Hs02_00360340 predicted 310
9 SASI_Hs02_00360341 predicted 620
10 SASI_Hs02_00360342 predicted 251
11 SASI_Hs01_00065093 predicted 530
12 SASI_Hs01_00065094 predicted 260
13 SASI_Hs01_00065096 predicted 656
14 SASI_Hs01_00065097 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210952 predicted 294
2 SASI_Rn02_00210953 predicted 224
3 SASI_Rn02_00210954 predicted 219
4 SASI_Rn02_00210955 predicted 344
5 SASI_Rn02_00210956 predicted 363
6 SASI_Rn02_00210957 predicted 210
7 SASI_Rn02_00210958 predicted 246
8 SASI_Rn02_00210959 predicted 279
9 SASI_Rn02_00210960 predicted 335
10 SASI_Rn02_00210961 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292160 predicted 1172
2 SASI_Mm02_00292161 predicted 994
3 SASI_Mm02_00292162 predicted 203
4 SASI_Mm02_00292163 predicted 519
5 SASI_Mm02_00292164 predicted 895
6 SASI_Mm02_00292165 predicted 1088
7 SASI_Mm02_00292166 predicted 372
8 SASI_Mm02_00292167 predicted 352
9 SASI_Mm02_00292168 predicted 629
10 SASI_Mm02_00292169 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336671 predicted 1177
2 SASI_Mm02_00336672 predicted 992
3 SASI_Mm02_00336673 predicted 207
4 SASI_Mm02_00336674 predicted 518
5 SASI_Mm02_00336675 predicted 890
6 SASI_Mm02_00336676 predicted 1083
7 SASI_Mm02_00336677 predicted 375
8 SASI_Mm02_00336678 predicted 348
9 SASI_Mm02_00336679 predicted 634
10 SASI_Mm02_00336680 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257396 predicted 341
2 SASI_Mm01_00257397 predicted 312
3 SASI_Mm01_00257398 predicted 306
4 SASI_Mm01_00257399 predicted 254
5 SASI_Mm01_00257400 predicted 233
6 SASI_Mm01_00257401 predicted 294
7 SASI_Mm01_00257402 predicted 231
8 SASI_Mm01_00257403 predicted 345
9 SASI_Mm01_00257404 predicted 245
10 SASI_Mm01_00257405 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032785
AGBL4 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032785.1-1976s1c1
Sequence:CCGGGCTCTGTTTGTATGTGTGTTTCTCGAGAAACACACATACAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-455s1c1
Sequence:CCGGGAAACAACTCATCGTCCAGATCTCGAGATCTGGACGATGAGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-373s1c1
Sequence:CCGGACAGGTGTTCTCTGATGGGATCTCGAGATCCCATCAGAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-788s1c1
Sequence:CCGGCTACACTGAAGAAGCCTGTATCTCGAGATACAGGCTTCTTCAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032785.3-619s21c1
Sequence:CCGGTTGACCGAGAAGAAGATATTTCTCGAGAAATATCTTCTTCTCGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032785.3-647s21c1
Sequence:CCGGTGCTTACTGCTACCCATATACCTCGAGGTATATGGGTAGCAGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-240s1c2
Sequence:CCGGCCCTCATCATTTGTGTGCCAACTCGAGTTGGCACACAAATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032785
AGBL4 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032785.1-1976s1c1
Sequence:CCGGGCTCTGTTTGTATGTGTGTTTCTCGAGAAACACACATACAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-455s1c1
Sequence:CCGGGAAACAACTCATCGTCCAGATCTCGAGATCTGGACGATGAGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-373s1c1
Sequence:CCGGACAGGTGTTCTCTGATGGGATCTCGAGATCCCATCAGAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-788s1c1
Sequence:CCGGCTACACTGAAGAAGCCTGTATCTCGAGATACAGGCTTCTTCAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032785.3-619s21c1
Sequence:CCGGTTGACCGAGAAGAAGATATTTCTCGAGAAATATCTTCTTCTCGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032785.3-647s21c1
Sequence:CCGGTGCTTACTGCTACCCATATACCTCGAGGTATATGGGTAGCAGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-240s1c2
Sequence:CCGGCCCTCATCATTTGTGTGCCAACTCGAGTTGGCACACAAATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032785
AGBL4 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032785.1-1976s1c1
Sequence:CCGGGCTCTGTTTGTATGTGTGTTTCTCGAGAAACACACATACAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-455s1c1
Sequence:CCGGGAAACAACTCATCGTCCAGATCTCGAGATCTGGACGATGAGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-373s1c1
Sequence:CCGGACAGGTGTTCTCTGATGGGATCTCGAGATCCCATCAGAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-788s1c1
Sequence:CCGGCTACACTGAAGAAGCCTGTATCTCGAGATACAGGCTTCTTCAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032785.3-619s21c1
Sequence:CCGGTTGACCGAGAAGAAGATATTTCTCGAGAAATATCTTCTTCTCGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032785.3-647s21c1
Sequence:CCGGTGCTTACTGCTACCCATATACCTCGAGGTATATGGGTAGCAGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032785.1-240s1c2
Sequence:CCGGCCCTCATCATTTGTGTGCCAACTCGAGTTGGCACACAAATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048189
AGBL4 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-993s21c1
Sequence:CCGGTGGAGTGAAACAGCTTATTATCTCGAGATAATAAGCTGTTTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-1332s21c1
Sequence:CCGGCTACACTGAAGAAGCCTATATCTCGAGATATAGGCTTCTTCAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048189.3-1598s21c1
Sequence:CCGGGTTCTGGTAAAGCACTCAATGCTCGAGCATTGAGTGCTTTACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-1430s21c1
Sequence:CCGGCCATGCCAAGACTTCGATTTACTCGAGTAAATCGAAGTCTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048189
AGBL4 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-993s21c1
Sequence:CCGGTGGAGTGAAACAGCTTATTATCTCGAGATAATAAGCTGTTTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-1332s21c1
Sequence:CCGGCTACACTGAAGAAGCCTATATCTCGAGATATAGGCTTCTTCAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048189.3-1598s21c1
Sequence:CCGGGTTCTGGTAAAGCACTCAATGCTCGAGCATTGAGTGCTTTACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-1430s21c1
Sequence:CCGGCCATGCCAAGACTTCGATTTACTCGAGTAAATCGAAGTCTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048189
AGBL4 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-993s21c1
Sequence:CCGGTGGAGTGAAACAGCTTATTATCTCGAGATAATAAGCTGTTTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-1332s21c1
Sequence:CCGGCTACACTGAAGAAGCCTATATCTCGAGATATAGGCTTCTTCAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048189.3-1598s21c1
Sequence:CCGGGTTCTGGTAAAGCACTCAATGCTCGAGCATTGAGTGCTTTACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048189.3-1430s21c1
Sequence:CCGGCCATGCCAAGACTTCGATTTACTCGAGTAAATCGAAGTCTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks