EMAIL THIS PAGE TO A FRIEND

AGBL5

ATP/GTP binding protein-like 5

121 Gene Product Result for
Gene ID:
Mouse(231093) ATP/GTP binding protein-like 5
Rat(362710) ATP/GTP binding protein-like 5
Zebrafish(445479) ATP/GTP binding protein-like 5
chicken(770678) ATP/GTP binding protein-like 5
domestic cat(101081287) ATP/GTP binding protein-like 5
cow(538585) ATP/GTP binding protein-like 5
Horse(100055532) ATP/GTP binding protein-like 5
dog(475695) ATP/GTP binding protein-like 5
naked mole-rat(101704503) ATP/GTP binding protein-like 5
domestic guinea pig(100716655) ATP/GTP binding protein-like 5
sheep(101112799) ATP/GTP binding protein-like 5
Domestic Rabbit(100352650) ATP/GTP binding protein-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071511 MISSION® esiRNA esiRNA human AGBL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035506 Rosetta Predictions human pricing
NM_001035507 Rosetta Predictions human pricing
NM_021831 Rosetta Predictions human pricing
NM_001126372 Rosetta Predictions rat pricing
XR_006450 Rosetta Predictions rat pricing
NM_001048192 Rosetta Predictions mouse pricing
NM_174849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207504 predicted 924
2 SASI_Hs01_00207505 predicted 378
3 SASI_Hs01_00207506 predicted 1380
4 SASI_Hs01_00207507 predicted 1698
5 SASI_Hs01_00207508 predicted 593
6 SASI_Hs01_00207509 predicted 802
7 SASI_Hs01_00207510 predicted 919
8 SASI_Hs01_00207511 predicted 1130
9 SASI_Hs01_00207512 predicted 221
10 SASI_Hs01_00207513 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048660 predicted 949
2 SASI_Hs01_00048661 predicted 407
3 SASI_Hs01_00048662 predicted 1409
4 SASI_Hs01_00048663 predicted 1720
5 SASI_Hs01_00048664 predicted 620
6 SASI_Hs01_00048665 predicted 825
7 SASI_Hs01_00048666 predicted 945
8 SASI_Hs01_00048667 predicted 1145
9 SASI_Hs01_00048668 predicted 249
10 SASI_Hs01_00048669 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155599 predicted 944
2 SASI_Hs01_00155600 predicted 406
3 SASI_Hs01_00155601 predicted 1410
4 SASI_Hs01_00155602 predicted 1723
5 SASI_Hs01_00155603 predicted 620
6 SASI_Hs01_00155604 predicted 818
7 SASI_Hs01_00155605 predicted 942
8 SASI_Hs01_00155606 predicted 1150
9 SASI_Hs01_00155607 predicted 248
10 SASI_Hs01_00155608 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253423 predicted 2073
2 SASI_Rn02_00253424 predicted 711
3 SASI_Rn02_00253425 predicted 1092
4 SASI_Rn02_00253426 predicted 1155
5 SASI_Rn02_00253427 predicted 1338
6 SASI_Rn02_00253428 predicted 1108
7 SASI_Rn02_00253429 predicted 1293
8 SASI_Rn02_00253430 predicted 607
9 SASI_Rn02_00253431 predicted 1299
10 SASI_Rn02_00253432 predicted 1851
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126567 predicted 245
2 SASI_Rn01_00126568 predicted 347
3 SASI_Rn01_00126569 predicted 725
4 SASI_Rn01_00126570 predicted 790
5 SASI_Rn01_00126571 predicted 745
6 SASI_Rn01_00126572 predicted 927
7 SASI_Rn01_00126573 predicted 228
8 SASI_Rn01_00126574 predicted 364
9 SASI_Rn01_00126575 predicted 377
10 SASI_Rn01_00126576 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292170 predicted 1715
2 SASI_Mm02_00292171 predicted 794
3 SASI_Mm02_00292172 predicted 1847
4 SASI_Mm02_00292173 predicted 934
5 SASI_Mm02_00292174 predicted 1725
6 SASI_Mm02_00292175 predicted 1029
7 SASI_Mm02_00292176 predicted 1127
8 SASI_Mm02_00292177 predicted 1308
9 SASI_Mm02_00292178 predicted 1586
10 SASI_Mm02_00292179 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139991 predicted 1633
2 SASI_Mm01_00139994 predicted 714
3 SASI_Mm02_00345496 predicted 1762
4 SASI_Mm01_00139996 predicted 851
5 SASI_Mm02_00345497 predicted 1640
6 SASI_Mm02_00345498 predicted 954
7 SASI_Mm02_00345499 predicted 1043
8 SASI_Mm02_00345500 predicted 1227
9 SASI_Mm02_00345501 predicted 1504
10 SASI_Mm02_00345502 predicted 1531
11 SASI_Mm01_00139989 predicted 312
12 SASI_Mm01_00139990 predicted 660
13 SASI_Mm01_00139992 predicted 740
14 SASI_Mm01_00139993 predicted 1590
15 SASI_Mm01_00139995 predicted 543
16 SASI_Mm01_00139997 predicted 712
17 SASI_Mm01_00139998 predicted 1948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021831
VALIDATED
AGBL5 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-932s21c1
Sequence:CCGGTTCGCAGGCAAGAGGATATTCCTCGAGGAATATCCTCTTGCCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-2962s21c1
Sequence:CCGGATTCCATGTGACAGCCGTTAACTCGAGTTAACGGCTGTCACATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-882s21c1
Sequence:CCGGCCCGTCTAGAGCAGCTATTTCCTCGAGGAAATAGCTGCTCTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-1063s21c1
Sequence:CCGGCCTCTTCGTCTTTAAGCTGATCTCGAGATCAGCTTAAAGACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-2501s21c1
Sequence:CCGGGCTGTCATGGTAATCGGGAAACTCGAGTTTCCCGATTACCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021831.3-2859s1c1
Sequence:CCGGCGGGTCTGATAATGCCTTTATCTCGAGATAAAGGCATTATCAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-1006s1c1
Sequence:CCGGCTCTTCGTCTTTAAGCTGATTCTCGAGAATCAGCTTAAAGACGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-1005s1c1
Sequence:CCGGCCTCTTCGTCTTTAAGCTGATCTCGAGATCAGCTTAAAGACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021831.3-1441s1c1
Sequence:CCGGGCTTACTATGTGGACCTGCATCTCGAGATGCAGGTCCACATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-2443s1c1
Sequence:CCGGGCTGTCATGGTAATCGGGAAACTCGAGTTTCCCGATTACCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021831
VALIDATED
AGBL5 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-932s21c1
Sequence:CCGGTTCGCAGGCAAGAGGATATTCCTCGAGGAATATCCTCTTGCCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-2962s21c1
Sequence:CCGGATTCCATGTGACAGCCGTTAACTCGAGTTAACGGCTGTCACATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-882s21c1
Sequence:CCGGCCCGTCTAGAGCAGCTATTTCCTCGAGGAAATAGCTGCTCTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-1063s21c1
Sequence:CCGGCCTCTTCGTCTTTAAGCTGATCTCGAGATCAGCTTAAAGACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-2501s21c1
Sequence:CCGGGCTGTCATGGTAATCGGGAAACTCGAGTTTCCCGATTACCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021831.3-2859s1c1
Sequence:CCGGCGGGTCTGATAATGCCTTTATCTCGAGATAAAGGCATTATCAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-1006s1c1
Sequence:CCGGCTCTTCGTCTTTAAGCTGATTCTCGAGAATCAGCTTAAAGACGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-1005s1c1
Sequence:CCGGCCTCTTCGTCTTTAAGCTGATCTCGAGATCAGCTTAAAGACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021831.3-1441s1c1
Sequence:CCGGGCTTACTATGTGGACCTGCATCTCGAGATGCAGGTCCACATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-2443s1c1
Sequence:CCGGGCTGTCATGGTAATCGGGAAACTCGAGTTTCCCGATTACCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021831
VALIDATED
AGBL5 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-932s21c1
Sequence:CCGGTTCGCAGGCAAGAGGATATTCCTCGAGGAATATCCTCTTGCCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-2962s21c1
Sequence:CCGGATTCCATGTGACAGCCGTTAACTCGAGTTAACGGCTGTCACATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-882s21c1
Sequence:CCGGCCCGTCTAGAGCAGCTATTTCCTCGAGGAAATAGCTGCTCTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-1063s21c1
Sequence:CCGGCCTCTTCGTCTTTAAGCTGATCTCGAGATCAGCTTAAAGACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021831.5-2501s21c1
Sequence:CCGGGCTGTCATGGTAATCGGGAAACTCGAGTTTCCCGATTACCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021831.3-2859s1c1
Sequence:CCGGCGGGTCTGATAATGCCTTTATCTCGAGATAAAGGCATTATCAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-1006s1c1
Sequence:CCGGCTCTTCGTCTTTAAGCTGATTCTCGAGAATCAGCTTAAAGACGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-1005s1c1
Sequence:CCGGCCTCTTCGTCTTTAAGCTGATCTCGAGATCAGCTTAAAGACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021831.3-1441s1c1
Sequence:CCGGGCTTACTATGTGGACCTGCATCTCGAGATGCAGGTCCACATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021831.3-2443s1c1
Sequence:CCGGGCTGTCATGGTAATCGGGAAACTCGAGTTTCCCGATTACCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174849
VALIDATED
AGBL5 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-833s1c1
Sequence:CCGGCCATTCCGTTTCACAGGCAAACTCGAGTTTGCCTGTGAAACGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-337s1c1
Sequence:CCGGCAACAGGTCATGGTTCTACTTCTCGAGAAGTAGAACCATGACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-1229s1c1
Sequence:CCGGGCCAATAATCTCCACAATGAACTCGAGTTCATTGTGGAGATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-1511s1c1
Sequence:CCGGCCAAAGCTCATCTCCTTGAATCTCGAGATTCAAGGAGATGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-535s1c1
Sequence:CCGGGCTATCCTTTGTTCACCGTTTCTCGAGAAACGGTGAACAAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174849
VALIDATED
AGBL5 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-833s1c1
Sequence:CCGGCCATTCCGTTTCACAGGCAAACTCGAGTTTGCCTGTGAAACGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-337s1c1
Sequence:CCGGCAACAGGTCATGGTTCTACTTCTCGAGAAGTAGAACCATGACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-1229s1c1
Sequence:CCGGGCCAATAATCTCCACAATGAACTCGAGTTCATTGTGGAGATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-1511s1c1
Sequence:CCGGCCAAAGCTCATCTCCTTGAATCTCGAGATTCAAGGAGATGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-535s1c1
Sequence:CCGGGCTATCCTTTGTTCACCGTTTCTCGAGAAACGGTGAACAAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174849
VALIDATED
AGBL5 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-833s1c1
Sequence:CCGGCCATTCCGTTTCACAGGCAAACTCGAGTTTGCCTGTGAAACGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-337s1c1
Sequence:CCGGCAACAGGTCATGGTTCTACTTCTCGAGAAGTAGAACCATGACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-1229s1c1
Sequence:CCGGGCCAATAATCTCCACAATGAACTCGAGTTCATTGTGGAGATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-1511s1c1
Sequence:CCGGCCAAAGCTCATCTCCTTGAATCTCGAGATTCAAGGAGATGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174849.2-535s1c1
Sequence:CCGGGCTATCCTTTGTTCACCGTTTCTCGAGAAACGGTGAACAAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks