EMAIL THIS PAGE TO A FRIEND

AGER

advanced glycosylation end product-specific receptor

78 Gene Product Result for
Synonyms: RAGE
Gene ID:
Human(177) Summary: The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
Mouse(11596) advanced glycosylation end product-specific receptor
Rat(81722) advanced glycosylation end product-specific receptor
sheep(101111586) advanced glycosylation end product-specific receptor
domestic guinea pig(100726130) advanced glycosylation end product-specific receptor
naked mole-rat(101709133) advanced glycosylation end product-specific receptor
dog(403168) advanced glycosylation end product-specific receptor
cow(280986) advanced glycosylation end product-specific receptor
domestic cat(101096892) advanced glycosylation end product-specific receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001136 Rosetta Predictions human pricing
NM_172197 Rosetta Predictions human pricing
NM_053336 Rosetta Predictions rat pricing
NM_007425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017224 predicted 424
2 SASI_Hs02_00331225 predicted 528
3 SASI_Hs01_00017225 predicted 576
4 SASI_Hs01_00017226 predicted 419
5 SASI_Hs01_00017227 predicted 476
6 SASI_Hs01_00017228 predicted 515
7 SASI_Hs01_00017229 predicted 564
8 SASI_Hs01_00017230 predicted 529
9 SASI_Hs01_00017231 predicted 471
10 SASI_Hs01_00017232 predicted 446
11 SASI_Hs01_00017233 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188511 predicted 490
2 SASI_Hs01_00188512 predicted 539
3 SASI_Hs01_00188513 predicted 379
4 SASI_Hs01_00188514 predicted 436
5 SASI_Hs01_00188515 predicted 468
6 SASI_Hs02_00367899 predicted 447
7 SASI_Hs01_00188516 predicted 519
8 SASI_Hs01_00188517 predicted 487
9 SASI_Hs01_00188518 predicted 438
10 SASI_Hs01_00188519 predicted 411
11 SASI_Hs01_00188520 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073056 predicted 530
2 SASI_Rn01_00073057 predicted 402
3 SASI_Rn01_00073058 predicted 1185
4 SASI_Rn01_00073059 predicted 529
5 SASI_Rn01_00073060 predicted 506
6 SASI_Rn01_00073061 predicted 443
7 SASI_Rn01_00073062 predicted 329
8 SASI_Rn01_00073063 predicted 1094
9 SASI_Rn01_00073064 predicted 298
10 SASI_Rn01_00073065 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050495 predicted 494
2 SASI_Mm02_00311573 predicted 512
3 SASI_Mm01_00050496 predicted 744
4 SASI_Mm01_00050497 predicted 628
5 SASI_Mm01_00050498 predicted 479
6 SASI_Mm02_00311574 predicted 480
7 SASI_Mm02_00311575 predicted 733
8 SASI_Mm02_00311576 predicted 520
9 SASI_Mm02_00311577 predicted 308
10 SASI_Mm02_00311578 predicted 459
11 SASI_Mm01_00050499 predicted 716
12 SASI_Mm01_00050500 predicted 538
13 SASI_Mm01_00050501 predicted 292
14 SASI_Mm01_00050502 predicted 517
15 SASI_Mm01_00050503 predicted 600
16 SASI_Mm01_00050504 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007425
AGER MISSION shRNA Bacterial Glycerol Stock
advanced glycosylation end product-specific receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-146s1c1
Sequence:CCGGGCAGCTAGAATGGAAACTGAACTCGAGTTCAGTTTCCATTCTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-342s1c1
Sequence:CCGGCGAGTCCGAGTCTACCAGATTCTCGAGAATCTGGTAGACTCGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-101s1c1
Sequence:CCGGGCCACTTGTGCTAAGCTGTAACTCGAGTTACAGCTTAGCACAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-1161s1c1
Sequence:CCGGGAGCTGAATCAGTCAGAGGAACTCGAGTTCCTCTGACTGATTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-503s1c1
Sequence:CCGGTGGCAAAGAAACACTCGTGAACTCGAGTTCACGAGTGTTTCTTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007425
AGER MISSION shRNA shRNA Plasmid DNA
advanced glycosylation end product-specific receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-146s1c1
Sequence:CCGGGCAGCTAGAATGGAAACTGAACTCGAGTTCAGTTTCCATTCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-342s1c1
Sequence:CCGGCGAGTCCGAGTCTACCAGATTCTCGAGAATCTGGTAGACTCGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-101s1c1
Sequence:CCGGGCCACTTGTGCTAAGCTGTAACTCGAGTTACAGCTTAGCACAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-1161s1c1
Sequence:CCGGGAGCTGAATCAGTCAGAGGAACTCGAGTTCCTCTGACTGATTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-503s1c1
Sequence:CCGGTGGCAAAGAAACACTCGTGAACTCGAGTTCACGAGTGTTTCTTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007425
AGER MISSION shRNA Lentiviral Transduction Particles
advanced glycosylation end product-specific receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-146s1c1
Sequence:CCGGGCAGCTAGAATGGAAACTGAACTCGAGTTCAGTTTCCATTCTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-342s1c1
Sequence:CCGGCGAGTCCGAGTCTACCAGATTCTCGAGAATCTGGTAGACTCGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-101s1c1
Sequence:CCGGGCCACTTGTGCTAAGCTGTAACTCGAGTTACAGCTTAGCACAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-1161s1c1
Sequence:CCGGGAGCTGAATCAGTCAGAGGAACTCGAGTTCCTCTGACTGATTCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007425.1-503s1c1
Sequence:CCGGTGGCAAAGAAACACTCGTGAACTCGAGTTCACGAGTGTTTCTTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136
AGER MISSION shRNA Bacterial Glycerol Stock
advanced glycosylation end product-specific receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-364s1c1
Sequence:CCGGCGAGTCCGTGTCTACCAGATTCTCGAGAATCTGGTAGACACGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-165s1c1
Sequence:CCGGGCGGCTGGAATGGAAACTGAACTCGAGTTCAGTTTCCATTCCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-528s1c1
Sequence:CCGGGAAGGGAGTATCTGTGAAGGACTCGAGTCCTTCACAGATACTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-963s1c1
Sequence:CCGGCCGTGCTGTCAGCATCAGCATCTCGAGATGCTGATGCTGACAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-1183s1c1
Sequence:CCGGGAACTGAATCAGTCGGAGGAACTCGAGTTCCTCCGACTGATTCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-390s21c1
Sequence:CCGGGAAGCCAGAAATTGTAGATTCCTCGAGGAATCTACAATTTCTGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-878s21c1
Sequence:CCGGTGCTGATCCTCCCTGAGATAGCTCGAGCTATCTCAGGGAGGATCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-582s21c1
Sequence:CCGGCACACTGCAGTCGGAGCTAATCTCGAGATTAGCTCCGACTGCAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136
AGER MISSION shRNA shRNA Plasmid DNA
advanced glycosylation end product-specific receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-364s1c1
Sequence:CCGGCGAGTCCGTGTCTACCAGATTCTCGAGAATCTGGTAGACACGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-165s1c1
Sequence:CCGGGCGGCTGGAATGGAAACTGAACTCGAGTTCAGTTTCCATTCCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-528s1c1
Sequence:CCGGGAAGGGAGTATCTGTGAAGGACTCGAGTCCTTCACAGATACTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-963s1c1
Sequence:CCGGCCGTGCTGTCAGCATCAGCATCTCGAGATGCTGATGCTGACAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-1183s1c1
Sequence:CCGGGAACTGAATCAGTCGGAGGAACTCGAGTTCCTCCGACTGATTCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-390s21c1
Sequence:CCGGGAAGCCAGAAATTGTAGATTCCTCGAGGAATCTACAATTTCTGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-878s21c1
Sequence:CCGGTGCTGATCCTCCCTGAGATAGCTCGAGCTATCTCAGGGAGGATCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-582s21c1
Sequence:CCGGCACACTGCAGTCGGAGCTAATCTCGAGATTAGCTCCGACTGCAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136
AGER MISSION shRNA Lentiviral Transduction Particles
advanced glycosylation end product-specific receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-364s1c1
Sequence:CCGGCGAGTCCGTGTCTACCAGATTCTCGAGAATCTGGTAGACACGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-165s1c1
Sequence:CCGGGCGGCTGGAATGGAAACTGAACTCGAGTTCAGTTTCCATTCCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-528s1c1
Sequence:CCGGGAAGGGAGTATCTGTGAAGGACTCGAGTCCTTCACAGATACTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-963s1c1
Sequence:CCGGCCGTGCTGTCAGCATCAGCATCTCGAGATGCTGATGCTGACAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001136.3-1183s1c1
Sequence:CCGGGAACTGAATCAGTCGGAGGAACTCGAGTTCCTCCGACTGATTCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-390s21c1
Sequence:CCGGGAAGCCAGAAATTGTAGATTCCTCGAGGAATCTACAATTTCTGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-878s21c1
Sequence:CCGGTGCTGATCCTCCCTGAGATAGCTCGAGCTATCTCAGGGAGGATCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136.3-582s21c1
Sequence:CCGGCACACTGCAGTCGGAGCTAATCTCGAGATTAGCTCCGACTGCAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)