EMAIL THIS PAGE TO A FRIEND

AGFG1

ArfGAP with FG repeats 1

Synonyms: HRB RAB RIP
Gene ID:
Human(3267) Summary: The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(15463) ArfGAP with FG repeats 1
Rat(363266) ArfGAP with FG repeats 1
chicken(424793) ArfGAP with FG repeats 1
dog(477396) ArfGAP with FG repeats 1
domestic cat(101088508) ArfGAP with FG repeats 1
cow(536149) ArfGAP with FG repeats 1
naked mole-rat(101714156) ArfGAP with FG repeats 1
domestic guinea pig(100715254) ArfGAP with FG repeats 1
sheep(101103789) ArfGAP with FG repeats 1
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004504 Rosetta Predictions human pricing
XM_343608 Rosetta Predictions rat pricing
XR_005463 Rosetta Predictions rat pricing
XR_009641 Rosetta Predictions rat pricing
NM_010472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169464 predicted 1542
2 SASI_Hs01_00169465 predicted 730
3 SASI_Hs02_00337763 predicted 488
4 SASI_Hs01_00169467 predicted 1763
5 SASI_Hs01_00169468 predicted 777
6 SASI_Hs01_00169469 predicted 1784
7 SASI_Hs01_00169470 predicted 559
8 SASI_Hs02_00337764 predicted 368
9 SASI_Hs01_00169471 predicted 1647
10 SASI_Hs01_00169472 predicted 838
11 SASI_Hs01_00169463 predicted 1866
12 SASI_Hs01_00169466 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182281 predicted 1008
2 SASI_Rn01_00182282 predicted 1118
3 SASI_Rn01_00182283 predicted 1030
4 SASI_Rn01_00182284 predicted 523
5 SASI_Rn01_00182285 predicted 1117
6 SASI_Rn01_00182286 predicted 507
7 SASI_Rn01_00182287 predicted 1070
8 SASI_Rn01_00182288 predicted 511
9 SASI_Rn01_00182289 predicted 469
10 SASI_Rn01_00182290 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409396 predicted 1276
2 SASI_Rn02_00409397 predicted 2720
3 SASI_Rn02_00409398 predicted 1908
4 SASI_Rn02_00409399 predicted 1383
5 SASI_Rn02_00409400 predicted 1303
6 SASI_Rn02_00409401 predicted 1522
7 SASI_Rn02_00409402 predicted 513
8 SASI_Rn02_00409403 predicted 2054
9 SASI_Rn02_00409404 predicted 1191
10 SASI_Rn02_00409405 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420575 predicted 2700
2 SASI_Rn02_00420576 predicted 1243
3 SASI_Rn02_00420577 predicted 1883
4 SASI_Rn02_00420578 predicted 1352
5 SASI_Rn02_00420579 predicted 1272
6 SASI_Rn02_00420580 predicted 951
7 SASI_Rn02_00420581 predicted 1486
8 SASI_Rn02_00420582 predicted 503
9 SASI_Rn02_00420583 predicted 649
10 SASI_Rn02_00420584 predicted 2026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069742 predicted 1258
2 SASI_Mm01_00069743 predicted 505
3 SASI_Mm01_00069744 predicted 1292
4 SASI_Mm01_00069745 predicted 751
5 SASI_Mm01_00069747 predicted 409
6 SASI_Mm02_00318677 predicted 1222
7 SASI_Mm01_00069748 predicted 977
8 SASI_Mm01_00069749 predicted 902
9 SASI_Mm01_00069750 predicted 1687
10 SASI_Mm02_00318678 predicted 1367
11 SASI_Mm01_00069746 predicted 1187
12 SASI_Mm01_00069751 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004504
VALIDATED
AGFG1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with FG repeats 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1341s21c1
Sequence:CCGGCCAGTCAGTCAAGTGCATCTTCTCGAGAAGATGCACTTGACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1413s21c1
Sequence:CCGGCCACCTCCAGTAATGCGTATACTCGAGTATACGCATTACTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-713s21c1
Sequence:CCGGCCTGAGGTCAAACCACTGAAACTCGAGTTTCAGTGGTTTGACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1073s21c1
Sequence:CCGGGCTGCATCAGTAAATGCTAATCTCGAGATTAGCATTTACTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-559s1c1
Sequence:CCGGCCTGAGGTCAAACCACTGAAACTCGAGTTTCAGTGGTTTGACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-919s1c1
Sequence:CCGGGCTGCATCAGTAAATGCTAATCTCGAGATTAGCATTTACTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1696s1c1
Sequence:CCGGGCTGCTGGAGTATCTAGTAATCTCGAGATTACTAGATACTCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1259s1c1
Sequence:CCGGCCACCTCCAGTAATGCGTATACTCGAGTATACGCATTACTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1187s1c1
Sequence:CCGGCCAGTCAGTCAAGTGCATCTTCTCGAGAAGATGCACTTGACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004504
VALIDATED
AGFG1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with FG repeats 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1341s21c1
Sequence:CCGGCCAGTCAGTCAAGTGCATCTTCTCGAGAAGATGCACTTGACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1413s21c1
Sequence:CCGGCCACCTCCAGTAATGCGTATACTCGAGTATACGCATTACTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-713s21c1
Sequence:CCGGCCTGAGGTCAAACCACTGAAACTCGAGTTTCAGTGGTTTGACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1073s21c1
Sequence:CCGGGCTGCATCAGTAAATGCTAATCTCGAGATTAGCATTTACTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-559s1c1
Sequence:CCGGCCTGAGGTCAAACCACTGAAACTCGAGTTTCAGTGGTTTGACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-919s1c1
Sequence:CCGGGCTGCATCAGTAAATGCTAATCTCGAGATTAGCATTTACTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1696s1c1
Sequence:CCGGGCTGCTGGAGTATCTAGTAATCTCGAGATTACTAGATACTCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1259s1c1
Sequence:CCGGCCACCTCCAGTAATGCGTATACTCGAGTATACGCATTACTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1187s1c1
Sequence:CCGGCCAGTCAGTCAAGTGCATCTTCTCGAGAAGATGCACTTGACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004504
VALIDATED
AGFG1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with FG repeats 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1341s21c1
Sequence:CCGGCCAGTCAGTCAAGTGCATCTTCTCGAGAAGATGCACTTGACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1413s21c1
Sequence:CCGGCCACCTCCAGTAATGCGTATACTCGAGTATACGCATTACTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-713s21c1
Sequence:CCGGCCTGAGGTCAAACCACTGAAACTCGAGTTTCAGTGGTTTGACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004504.4-1073s21c1
Sequence:CCGGGCTGCATCAGTAAATGCTAATCTCGAGATTAGCATTTACTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-559s1c1
Sequence:CCGGCCTGAGGTCAAACCACTGAAACTCGAGTTTCAGTGGTTTGACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-919s1c1
Sequence:CCGGGCTGCATCAGTAAATGCTAATCTCGAGATTAGCATTTACTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1696s1c1
Sequence:CCGGGCTGCTGGAGTATCTAGTAATCTCGAGATTACTAGATACTCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1259s1c1
Sequence:CCGGCCACCTCCAGTAATGCGTATACTCGAGTATACGCATTACTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004504.3-1187s1c1
Sequence:CCGGCCAGTCAGTCAAGTGCATCTTCTCGAGAAGATGCACTTGACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010472
VALIDATED
AGFG1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with FG repeats 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-1779s21c1
Sequence:CCGGCGCCACGTTTGGACAAACAAACTCGAGTTTGTTTGTCCAAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-984s21c1
Sequence:CCGGGTCTAGTGGTTCGAGTAATTTCTCGAGAAATTACTCGAACCACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-649s21c1
Sequence:CCGGGCCTCGGTTCATGCGTCTATTCTCGAGAATAGACGCATGAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-1936s21c1
Sequence:CCGGGTACCGGAACGAACGTTTATGCTCGAGCATAAACGTTCGTTCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-510s21c1
Sequence:CCGGACAGATATGGCTAGGATTATTCTCGAGAATAATCCTAGCCATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010472.1-2566s1c1
Sequence:CCGGGCCTTTACCAAAGTGGCCTTACTCGAGTAAGGCCACTTTGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-1211s1c1
Sequence:CCGGGCAGACAAATATGCGGCACTTCTCGAGAAGTGCCGCATATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-651s1c1
Sequence:CCGGCCTCGGTTCATGCGTCTATTTCTCGAGAAATAGACGCATGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010472.1-507s1c1
Sequence:CCGGGCAAACAGATATGGCTAGGATCTCGAGATCCTAGCCATATCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-1780s1c1
Sequence:CCGGCGCCACGTTTGGACAAACAAACTCGAGTTTGTTTGTCCAAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010472
VALIDATED
AGFG1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with FG repeats 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-1779s21c1
Sequence:CCGGCGCCACGTTTGGACAAACAAACTCGAGTTTGTTTGTCCAAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-984s21c1
Sequence:CCGGGTCTAGTGGTTCGAGTAATTTCTCGAGAAATTACTCGAACCACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-649s21c1
Sequence:CCGGGCCTCGGTTCATGCGTCTATTCTCGAGAATAGACGCATGAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-1936s21c1
Sequence:CCGGGTACCGGAACGAACGTTTATGCTCGAGCATAAACGTTCGTTCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-510s21c1
Sequence:CCGGACAGATATGGCTAGGATTATTCTCGAGAATAATCCTAGCCATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010472.1-2566s1c1
Sequence:CCGGGCCTTTACCAAAGTGGCCTTACTCGAGTAAGGCCACTTTGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-1211s1c1
Sequence:CCGGGCAGACAAATATGCGGCACTTCTCGAGAAGTGCCGCATATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-651s1c1
Sequence:CCGGCCTCGGTTCATGCGTCTATTTCTCGAGAAATAGACGCATGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010472.1-507s1c1
Sequence:CCGGGCAAACAGATATGGCTAGGATCTCGAGATCCTAGCCATATCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-1780s1c1
Sequence:CCGGCGCCACGTTTGGACAAACAAACTCGAGTTTGTTTGTCCAAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010472
VALIDATED
AGFG1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with FG repeats 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-1779s21c1
Sequence:CCGGCGCCACGTTTGGACAAACAAACTCGAGTTTGTTTGTCCAAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-984s21c1
Sequence:CCGGGTCTAGTGGTTCGAGTAATTTCTCGAGAAATTACTCGAACCACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-649s21c1
Sequence:CCGGGCCTCGGTTCATGCGTCTATTCTCGAGAATAGACGCATGAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-1936s21c1
Sequence:CCGGGTACCGGAACGAACGTTTATGCTCGAGCATAAACGTTCGTTCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010472.2-510s21c1
Sequence:CCGGACAGATATGGCTAGGATTATTCTCGAGAATAATCCTAGCCATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010472.1-2566s1c1
Sequence:CCGGGCCTTTACCAAAGTGGCCTTACTCGAGTAAGGCCACTTTGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-1211s1c1
Sequence:CCGGGCAGACAAATATGCGGCACTTCTCGAGAAGTGCCGCATATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-651s1c1
Sequence:CCGGCCTCGGTTCATGCGTCTATTTCTCGAGAAATAGACGCATGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010472.1-507s1c1
Sequence:CCGGGCAAACAGATATGGCTAGGATCTCGAGATCCTAGCCATATCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010472.1-1780s1c1
Sequence:CCGGCGCCACGTTTGGACAAACAAACTCGAGTTTGTTTGTCCAAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks