EMAIL THIS PAGE TO A FRIEND

AGFG2

ArfGAP with FG repeats 2

111 Gene Product Result for
Synonyms: HRBL RABR
UniProtKB ID: O95081, O75429, Q96AB9, Q96GL4
Gene ID:
Human(3268) Summary: This gene is a member of the HIV-1 Rev binding protein (HRB) family and encodes a protein with one Arf-GAP zinc finger domain, several phe-gly (FG) motifs, and four asn-pro-phe (NPF) motifs. This protein interacts with Eps15 homology (EH) domains and plays a role in the Rev export pathway, which mediates the nucleocytoplasmic transfer of proteins and RNAs. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Feb 2013]
Mouse(231801) ArfGAP with FG repeats 2
Rat(304375) ArfGAP with FG repeats 2
dog(489837) ArfGAP with FG repeats 2
Horse(100068998) ArfGAP with FG repeats 2
cow(510361) ArfGAP with FG repeats 2
domestic cat(101091069) ArfGAP with FG repeats 2
domestic guinea pig(100723922) ArfGAP with FG repeats 2
naked mole-rat(101720847) ArfGAP with FG repeats 2
sheep(101104547) ArfGAP with FG repeats 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006076 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098871 MISSION® esiRNA esiRNA human AGFG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006076 Rosetta Predictions human pricing
NM_001107131 Rosetta Predictions rat pricing
NM_145566 Rosetta Predictions mouse pricing
NM_178162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340846 predicted 941
2 SASI_Hs01_00070602 predicted 1643
3 SASI_Hs01_00070603 predicted 669
4 SASI_Hs01_00070604 predicted 1017
5 SASI_Hs01_00070606 predicted 903
6 SASI_Hs01_00070608 predicted 1646
7 SASI_Hs01_00070610 predicted 1279
8 SASI_Hs02_00340847 predicted 1512
9 SASI_Hs02_00340848 predicted 1441
10 SASI_Hs02_00340849 predicted 587
11 SASI_Hs01_00070605 predicted 462
12 SASI_Hs01_00070607 predicted 1988
13 SASI_Hs01_00070609 predicted 501
14 SASI_Hs01_00070611 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225806 predicted 1237
2 SASI_Rn02_00225807 predicted 1766
3 SASI_Rn02_00225808 predicted 1154
4 SASI_Rn02_00225809 predicted 1373
5 SASI_Rn02_00225810 predicted 1759
6 SASI_Rn02_00225811 predicted 1586
7 SASI_Rn02_00225812 predicted 906
8 SASI_Rn02_00225813 predicted 1759
9 SASI_Rn02_00225814 predicted 1100
10 SASI_Rn02_00225815 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066558 predicted 412
2 SASI_Mm01_00066559 predicted 459
3 SASI_Mm01_00066560 predicted 420
4 SASI_Mm01_00066561 predicted 350
5 SASI_Mm01_00066562 predicted 572
6 SASI_Mm02_00341075 predicted 623
7 SASI_Mm01_00066563 predicted 456
8 SASI_Mm01_00066564 predicted 480
9 SASI_Mm01_00066565 predicted 571
10 SASI_Mm01_00066566 predicted 352
11 SASI_Mm01_00066567 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095684 predicted 335
2 SASI_Mm01_00095685 predicted 390
3 SASI_Mm01_00095686 predicted 337
4 SASI_Mm01_00095687 predicted 273
5 SASI_Mm01_00095688 predicted 488
6 SASI_Mm02_00348605 predicted 547
7 SASI_Mm01_00095689 predicted 383
8 SASI_Mm01_00095690 predicted 404
9 SASI_Mm01_00095691 predicted 494
10 SASI_Mm01_00095692 predicted 273
11 SASI_Mm01_00095693 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178162
AGFG2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with FG repeats 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178162.2-1941s1c1
Sequence:CCGGGCTCGAATGTAGGGTAAAGATCTCGAGATCTTTACCCTACATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-390s1c1
Sequence:CCGGCGGACATCGTTGATACCAGATCTCGAGATCTGGTATCAACGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-1399s1c1
Sequence:CCGGCTGGGATCTCTACCAATCCTTCTCGAGAAGGATTGGTAGAGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-329s1c1
Sequence:CCGGGTTCCTCCAATCTCGTGGAAACTCGAGTTTCCACGAGATTGGAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-1170s1c1
Sequence:CCGGCCTTCTACCAACCCATTCCAACTCGAGTTGGAATGGGTTGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-390s21c1
Sequence:CCGGCGGACATCGTTGATACCAGATCTCGAGATCTGGTATCAACGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178162.2-1941s21c1
Sequence:CCGGGCTCGAATGTAGGGTAAAGATCTCGAGATCTTTACCCTACATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-1399s21c1
Sequence:CCGGCTGGGATCTCTACCAATCCTTCTCGAGAAGGATTGGTAGAGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-1170s21c1
Sequence:CCGGCCTTCTACCAACCCATTCCAACTCGAGTTGGAATGGGTTGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178162
AGFG2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with FG repeats 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178162.2-1941s1c1
Sequence:CCGGGCTCGAATGTAGGGTAAAGATCTCGAGATCTTTACCCTACATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-390s1c1
Sequence:CCGGCGGACATCGTTGATACCAGATCTCGAGATCTGGTATCAACGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-1399s1c1
Sequence:CCGGCTGGGATCTCTACCAATCCTTCTCGAGAAGGATTGGTAGAGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-329s1c1
Sequence:CCGGGTTCCTCCAATCTCGTGGAAACTCGAGTTTCCACGAGATTGGAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-1170s1c1
Sequence:CCGGCCTTCTACCAACCCATTCCAACTCGAGTTGGAATGGGTTGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-390s21c1
Sequence:CCGGCGGACATCGTTGATACCAGATCTCGAGATCTGGTATCAACGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178162.2-1941s21c1
Sequence:CCGGGCTCGAATGTAGGGTAAAGATCTCGAGATCTTTACCCTACATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-1399s21c1
Sequence:CCGGCTGGGATCTCTACCAATCCTTCTCGAGAAGGATTGGTAGAGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-1170s21c1
Sequence:CCGGCCTTCTACCAACCCATTCCAACTCGAGTTGGAATGGGTTGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178162
AGFG2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with FG repeats 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178162.2-1941s1c1
Sequence:CCGGGCTCGAATGTAGGGTAAAGATCTCGAGATCTTTACCCTACATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-390s1c1
Sequence:CCGGCGGACATCGTTGATACCAGATCTCGAGATCTGGTATCAACGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-1399s1c1
Sequence:CCGGCTGGGATCTCTACCAATCCTTCTCGAGAAGGATTGGTAGAGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-329s1c1
Sequence:CCGGGTTCCTCCAATCTCGTGGAAACTCGAGTTTCCACGAGATTGGAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178162.2-1170s1c1
Sequence:CCGGCCTTCTACCAACCCATTCCAACTCGAGTTGGAATGGGTTGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-390s21c1
Sequence:CCGGCGGACATCGTTGATACCAGATCTCGAGATCTGGTATCAACGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178162.2-1941s21c1
Sequence:CCGGGCTCGAATGTAGGGTAAAGATCTCGAGATCTTTACCCTACATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-1399s21c1
Sequence:CCGGCTGGGATCTCTACCAATCCTTCTCGAGAAGGATTGGTAGAGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178162.2-1170s21c1
Sequence:CCGGCCTTCTACCAACCCATTCCAACTCGAGTTGGAATGGGTTGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006076
VALIDATED
AGFG2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with FG repeats 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006076.3-440s1c1
Sequence:CCGGCGGACATCTTTAGTACCAGATCTCGAGATCTGGTACTAAAGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006076.3-867s1c1
Sequence:CCGGCCAACTTTGATGCCTTTAGCACTCGAGTGCTAAAGGCATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006076.3-368s1c1
Sequence:CCGGCCTGAAGTAGTATTCCTGCAACTCGAGTTGCAGGAATACTACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006076.3-340s1c1
Sequence:CCGGGTCAATCTCCATGACAACTTTCTCGAGAAAGTTGTCATGGAGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006076.4-1451s21c1
Sequence:CCGGGACTTAGGATCAGCCAAGTTGCTCGAGCAACTTGGCTGATCCTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006076.4-553s21c1
Sequence:CCGGTGAGAAGAAGAGATGGTATGTCTCGAGACATACCATCTCTTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006076
VALIDATED
AGFG2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with FG repeats 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006076.3-440s1c1
Sequence:CCGGCGGACATCTTTAGTACCAGATCTCGAGATCTGGTACTAAAGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006076.3-867s1c1
Sequence:CCGGCCAACTTTGATGCCTTTAGCACTCGAGTGCTAAAGGCATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006076.3-368s1c1
Sequence:CCGGCCTGAAGTAGTATTCCTGCAACTCGAGTTGCAGGAATACTACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006076.3-340s1c1
Sequence:CCGGGTCAATCTCCATGACAACTTTCTCGAGAAAGTTGTCATGGAGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006076.4-1451s21c1
Sequence:CCGGGACTTAGGATCAGCCAAGTTGCTCGAGCAACTTGGCTGATCCTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006076.4-553s21c1
Sequence:CCGGTGAGAAGAAGAGATGGTATGTCTCGAGACATACCATCTCTTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006076
VALIDATED
AGFG2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with FG repeats 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006076.3-440s1c1
Sequence:CCGGCGGACATCTTTAGTACCAGATCTCGAGATCTGGTACTAAAGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006076.3-867s1c1
Sequence:CCGGCCAACTTTGATGCCTTTAGCACTCGAGTGCTAAAGGCATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006076.3-368s1c1
Sequence:CCGGCCTGAAGTAGTATTCCTGCAACTCGAGTTGCAGGAATACTACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006076.3-340s1c1
Sequence:CCGGGTCAATCTCCATGACAACTTTCTCGAGAAAGTTGTCATGGAGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006076.4-1451s21c1
Sequence:CCGGGACTTAGGATCAGCCAAGTTGCTCGAGCAACTTGGCTGATCCTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006076.4-553s21c1
Sequence:CCGGTGAGAAGAAGAGATGGTATGTCTCGAGACATACCATCTCTTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks