EMAIL THIS PAGE TO A FRIEND

AGGF1

angiogenic factor with G patch and FHA domains 1

116 Gene Product Result for
Synonyms: GPATC7 GPATCH7 HSU84971 HUS84971 VG5Q
UniProtKB ID: Q8N302, O00581, Q53YS3, Q9BU84, Q9NW66
Gene ID:
Human(55109) Summary: This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
Mouse(66549) angiogenic factor with G patch and FHA domains 1
Rat(310005) angiogenic factor with G patch and FHA domains 1
Zebrafish(559905) angiogenic factor with G patch and FHA domains 1
cow(511650) angiogenic factor with G patch and FHA domains 1
Horse(100073274) angiogenic factor with G patch and FHA domains 1
dog(479176) angiogenic factor with G patch and FHA domains 1
chicken(416364) angiogenic factor with G patch and FHA domains 1
naked mole-rat(101711176) angiogenic factor with G patch and FHA domains 1
domestic guinea pig(100722136) angiogenic factor with G patch and FHA domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018046 Rosetta Predictions human pricing
XM_001060407 Rosetta Predictions rat pricing
XM_226709 Rosetta Predictions rat pricing
NM_025630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103567 predicted 2727
2 SASI_Hs01_00103568 predicted 722
3 SASI_Hs01_00103569 predicted 908
4 SASI_Hs01_00103570 predicted 699
5 SASI_Hs02_00351169 predicted 2729
6 SASI_Hs02_00351170 predicted 905
7 SASI_Hs01_00103572 predicted 740
8 SASI_Hs01_00103573 predicted 641
9 SASI_Hs01_00103574 predicted 774
10 SASI_Hs02_00351171 predicted 905
11 SASI_Hs01_00103566 predicted 2775
12 SASI_Hs01_00103571 predicted 2782
13 SASI_Hs01_00103575 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296424 predicted 567
2 SASI_Rn02_00296425 predicted 611
3 SASI_Rn02_00296426 predicted 1925
4 SASI_Rn02_00296427 predicted 1623
5 SASI_Rn02_00296428 predicted 1817
6 SASI_Rn02_00296429 predicted 962
7 SASI_Rn02_00296430 predicted 510
8 SASI_Rn02_00296431 predicted 945
9 SASI_Rn02_00296432 predicted 725
10 SASI_Rn02_00296433 predicted 1889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383815 predicted 781
2 SASI_Rn02_00383816 predicted 1125
3 SASI_Rn02_00383817 predicted 674
4 SASI_Rn02_00383818 predicted 1111
5 SASI_Rn02_00383819 predicted 887
6 SASI_Rn02_00383820 predicted 1078
7 SASI_Rn02_00383821 predicted 1044
8 SASI_Rn02_00383822 predicted 664
9 SASI_Rn02_00383823 predicted 851
10 SASI_Rn02_00383824 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328689 predicted 722
2 SASI_Mm02_00328690 predicted 1611
3 SASI_Mm02_00328691 predicted 2472
4 SASI_Mm01_00050617 predicted 2117
5 SASI_Mm01_00050618 predicted 1400
6 SASI_Mm01_00050619 predicted 2008
7 SASI_Mm01_00050620 predicted 1601
8 SASI_Mm01_00050621 predicted 1440
9 SASI_Mm01_00050622 predicted 2257
10 SASI_Mm01_00050623 predicted 2305
11 SASI_Mm01_00050615 predicted 1491
12 SASI_Mm01_00050616 predicted 1704
13 SASI_Mm01_00050624 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018046
VALIDATED
AGGF1 MISSION shRNA Bacterial Glycerol Stock
angiogenic factor with G patch and FHA domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-699s21c1
Sequence:CCGGTGACGTTAGTCTTCCAAATAACTCGAGTTATTTGGAAGACTAACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-1201s21c1
Sequence:CCGGCCAGATTCTTCTGCAACAAATCTCGAGATTTGTTGCAGAAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018046.3-2680s21c1
Sequence:CCGGATAGTGACTGAACCAATTTATCTCGAGATAAATTGGTTCAGTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-1060s21c1
Sequence:CCGGGATCCTTCCACTGGAATTTATCTCGAGATAAATTCCAGTGGAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-2498s21c1
Sequence:CCGGTAGAGTGAAGGCTAATCATAGCTCGAGCTATGATTAGCCTTCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018046.2-2169s1c1
Sequence:CCGGCCTGCATCTGTTCATTCTGAACTCGAGTTCAGAATGAACAGATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_018046.2-901s1c1
Sequence:CCGGGCTCATCATTAGCTGAAAGTTCTCGAGAACTTTCAGCTAATGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018046.2-1081s1c1
Sequence:CCGGGTGGTCGTTATCAGTTTCATTCTCGAGAATGAAACTGATAACGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018046.2-2901s1c1
Sequence:CCGGGCATCCTCATTTATTCCCTTTCTCGAGAAAGGGAATAAATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018046.2-1479s1c1
Sequence:CCGGGATAGTTATGACGAAGCCATTCTCGAGAATGGCTTCGTCATAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018046
VALIDATED
AGGF1 MISSION shRNA shRNA Plasmid DNA
angiogenic factor with G patch and FHA domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-699s21c1
Sequence:CCGGTGACGTTAGTCTTCCAAATAACTCGAGTTATTTGGAAGACTAACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-1201s21c1
Sequence:CCGGCCAGATTCTTCTGCAACAAATCTCGAGATTTGTTGCAGAAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018046.3-2680s21c1
Sequence:CCGGATAGTGACTGAACCAATTTATCTCGAGATAAATTGGTTCAGTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-1060s21c1
Sequence:CCGGGATCCTTCCACTGGAATTTATCTCGAGATAAATTCCAGTGGAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-2498s21c1
Sequence:CCGGTAGAGTGAAGGCTAATCATAGCTCGAGCTATGATTAGCCTTCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018046.2-2169s1c1
Sequence:CCGGCCTGCATCTGTTCATTCTGAACTCGAGTTCAGAATGAACAGATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_018046.2-901s1c1
Sequence:CCGGGCTCATCATTAGCTGAAAGTTCTCGAGAACTTTCAGCTAATGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018046.2-1081s1c1
Sequence:CCGGGTGGTCGTTATCAGTTTCATTCTCGAGAATGAAACTGATAACGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018046.2-2901s1c1
Sequence:CCGGGCATCCTCATTTATTCCCTTTCTCGAGAAAGGGAATAAATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018046.2-1479s1c1
Sequence:CCGGGATAGTTATGACGAAGCCATTCTCGAGAATGGCTTCGTCATAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018046
VALIDATED
AGGF1 MISSION shRNA Lentiviral Transduction Particles
angiogenic factor with G patch and FHA domains 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-699s21c1
Sequence:CCGGTGACGTTAGTCTTCCAAATAACTCGAGTTATTTGGAAGACTAACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-1201s21c1
Sequence:CCGGCCAGATTCTTCTGCAACAAATCTCGAGATTTGTTGCAGAAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018046.3-2680s21c1
Sequence:CCGGATAGTGACTGAACCAATTTATCTCGAGATAAATTGGTTCAGTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-1060s21c1
Sequence:CCGGGATCCTTCCACTGGAATTTATCTCGAGATAAATTCCAGTGGAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018046.3-2498s21c1
Sequence:CCGGTAGAGTGAAGGCTAATCATAGCTCGAGCTATGATTAGCCTTCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018046.2-2169s1c1
Sequence:CCGGCCTGCATCTGTTCATTCTGAACTCGAGTTCAGAATGAACAGATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_018046.2-901s1c1
Sequence:CCGGGCTCATCATTAGCTGAAAGTTCTCGAGAACTTTCAGCTAATGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018046.2-1081s1c1
Sequence:CCGGGTGGTCGTTATCAGTTTCATTCTCGAGAATGAAACTGATAACGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018046.2-2901s1c1
Sequence:CCGGGCATCCTCATTTATTCCCTTTCTCGAGAAAGGGAATAAATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018046.2-1479s1c1
Sequence:CCGGGATAGTTATGACGAAGCCATTCTCGAGAATGGCTTCGTCATAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025630
VALIDATED
AGGF1 MISSION shRNA Bacterial Glycerol Stock
angiogenic factor with G patch and FHA domains 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-2833s21c1
Sequence:CCGGATGGGTAGTGGAGCCTAATTTCTCGAGAAATTAGGCTCCACTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-904s21c1
Sequence:CCGGGACGAGAGCACGGGCTTATATCTCGAGATATAAGCCCGTGCTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-1318s21c1
Sequence:CCGGGATAACTCAGCGTCATCTAAGCTCGAGCTTAGATGACGCTGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-580s21c1
Sequence:CCGGTGGGCGATTTCAGATTATTACCTCGAGGTAATAATCTGAAATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-1900s21c1
Sequence:CCGGGTCGGTCCAGCACTAAGTAAGCTCGAGCTTACTTAGTGCTGGACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-1328s1c1
Sequence:CCGGCGTCATCTAAGGATGAGAGAACTCGAGTTCTCTCATCCTTAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-486s1c1
Sequence:CCGGGCAGGTAGAAGAACTTAGTAACTCGAGTTACTAAGTTCTTCTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-1638s1c1
Sequence:CCGGCGCAGAAGTTTACTTCGACCACTCGAGTGGTCGAAGTAAACTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025630
VALIDATED
AGGF1 MISSION shRNA shRNA Plasmid DNA
angiogenic factor with G patch and FHA domains 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-2833s21c1
Sequence:CCGGATGGGTAGTGGAGCCTAATTTCTCGAGAAATTAGGCTCCACTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-904s21c1
Sequence:CCGGGACGAGAGCACGGGCTTATATCTCGAGATATAAGCCCGTGCTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-1318s21c1
Sequence:CCGGGATAACTCAGCGTCATCTAAGCTCGAGCTTAGATGACGCTGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-580s21c1
Sequence:CCGGTGGGCGATTTCAGATTATTACCTCGAGGTAATAATCTGAAATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-1900s21c1
Sequence:CCGGGTCGGTCCAGCACTAAGTAAGCTCGAGCTTACTTAGTGCTGGACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-1328s1c1
Sequence:CCGGCGTCATCTAAGGATGAGAGAACTCGAGTTCTCTCATCCTTAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-486s1c1
Sequence:CCGGGCAGGTAGAAGAACTTAGTAACTCGAGTTACTAAGTTCTTCTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-1638s1c1
Sequence:CCGGCGCAGAAGTTTACTTCGACCACTCGAGTGGTCGAAGTAAACTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025630
VALIDATED
AGGF1 MISSION shRNA Lentiviral Transduction Particles
angiogenic factor with G patch and FHA domains 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-2833s21c1
Sequence:CCGGATGGGTAGTGGAGCCTAATTTCTCGAGAAATTAGGCTCCACTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-904s21c1
Sequence:CCGGGACGAGAGCACGGGCTTATATCTCGAGATATAAGCCCGTGCTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-1318s21c1
Sequence:CCGGGATAACTCAGCGTCATCTAAGCTCGAGCTTAGATGACGCTGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-580s21c1
Sequence:CCGGTGGGCGATTTCAGATTATTACCTCGAGGTAATAATCTGAAATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025630.2-1900s21c1
Sequence:CCGGGTCGGTCCAGCACTAAGTAAGCTCGAGCTTACTTAGTGCTGGACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-1328s1c1
Sequence:CCGGCGTCATCTAAGGATGAGAGAACTCGAGTTCTCTCATCCTTAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-486s1c1
Sequence:CCGGGCAGGTAGAAGAACTTAGTAACTCGAGTTACTAAGTTCTTCTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025630.2-1638s1c1
Sequence:CCGGCGCAGAAGTTTACTTCGACCACTCGAGTGGTCGAAGTAAACTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks