EMAIL THIS PAGE TO A FRIEND

AGK

acylglycerol kinase

92 Gene Product Result for
Synonyms: CATC5 CTRCT38 MTDPS10 MULK
UniProtKB ID: Q53H12, Q75KN1, Q96GC3, Q9NP48
Gene ID:
Human(55750) Summary: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10. [provided by RefSeq, Feb 2012]
Mouse(69923) acylglycerol kinase
Rat(502749) acylglycerol kinase
Zebrafish(334270) acylglycerol kinase
cow(514693) acylglycerol kinase
Horse(100064603) acylglycerol kinase
domestic cat(101092595) acylglycerol kinase
dog(482764) acylglycerol kinase
chicken(418121) acylglycerol kinase
naked mole-rat(101705295) acylglycerol kinase
domestic guinea pig(100733720) acylglycerol kinase
sheep(101108220) acylglycerol kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018238 Rosetta Predictions human pricing
NM_001127497 Rosetta Predictions rat pricing
NM_023538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240526 predicted 345
2 SASI_Hs01_00240528 predicted 734
3 SASI_Hs01_00240530 predicted 806
4 SASI_Hs01_00240531 predicted 560
5 SASI_Hs02_00351579 predicted 1184
6 SASI_Hs02_00351580 predicted 275
7 SASI_Hs01_00240532 predicted 839
8 SASI_Hs01_00240533 predicted 598
9 SASI_Hs01_00240534 predicted 651
10 SASI_Hs02_00351581 predicted 324
11 SASI_Hs01_00240527 predicted 324
12 SASI_Hs01_00240529 predicted 557
13 SASI_Hs01_00240535 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253923 predicted 350
2 SASI_Rn02_00253924 predicted 436
3 SASI_Rn02_00253925 predicted 1232
4 SASI_Rn02_00253926 predicted 613
5 SASI_Rn02_00253927 predicted 1021
6 SASI_Rn02_00253928 predicted 1078
7 SASI_Rn02_00253929 predicted 871
8 SASI_Rn02_00253930 predicted 203
9 SASI_Rn02_00253931 predicted 554
10 SASI_Rn02_00253932 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156918 predicted 723
2 SASI_Mm01_00156919 predicted 689
3 SASI_Mm01_00156920 predicted 478
4 SASI_Mm01_00156921 predicted 206
5 SASI_Mm02_00327180 predicted 437
6 SASI_Mm01_00156922 predicted 718
7 SASI_Mm01_00156923 predicted 519
8 SASI_Mm01_00156924 predicted 224
9 SASI_Mm02_00327181 predicted 1283
10 SASI_Mm01_00156925 predicted 643
11 SASI_Mm01_00156917 predicted 624
12 SASI_Mm01_00156926 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023538
VALIDATED
AGK MISSION shRNA Bacterial Glycerol Stock
acylglycerol kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-219s1c1
Sequence:CCGGCCCAATGCACAAGTGAAGAAACTCGAGTTTCTTCACTTGTGCATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-438s1c1
Sequence:CCGGCAGGAGGTTGTTACTGGAGTACTCGAGTACTCCAGTAACAACCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-545s1c1
Sequence:CCGGCTTTGCTGAAAGTGGAAACAACTCGAGTTGTTTCCACTTTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023538.1-868s1c1
Sequence:CCGGCGTCTCTGTATAGGAGAATATCTCGAGATATTCTCCTATACAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-1019s1c1
Sequence:CCGGCCTGATGAGCAAAGAGGATTTCTCGAGAAATCCTCTTTGCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023538.1-1812s21c1
Sequence:CCGGGTGAGGTTGTTCCCTCTTTAGCTCGAGCTAAAGAGGGAACAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-557s21c1
Sequence:CCGGTGGAAACAAAGTCCAACATATCTCGAGATATGTTGGACTTTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-339s21c1
Sequence:CCGGACTGTTGTCAAGACGGATTATCTCGAGATAATCCGTCTTGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-273s21c1
Sequence:CCGGGGCAAAGCCAGAACTCTATTTCTCGAGAAATAGAGTTCTGGCTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023538.1-1493s21c1
Sequence:CCGGTTGTGGTCAGTACCCTGTTAACTCGAGTTAACAGGGTACTGACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023538
VALIDATED
AGK MISSION shRNA shRNA Plasmid DNA
acylglycerol kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-219s1c1
Sequence:CCGGCCCAATGCACAAGTGAAGAAACTCGAGTTTCTTCACTTGTGCATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-438s1c1
Sequence:CCGGCAGGAGGTTGTTACTGGAGTACTCGAGTACTCCAGTAACAACCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-545s1c1
Sequence:CCGGCTTTGCTGAAAGTGGAAACAACTCGAGTTGTTTCCACTTTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023538.1-868s1c1
Sequence:CCGGCGTCTCTGTATAGGAGAATATCTCGAGATATTCTCCTATACAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-1019s1c1
Sequence:CCGGCCTGATGAGCAAAGAGGATTTCTCGAGAAATCCTCTTTGCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023538.1-1812s21c1
Sequence:CCGGGTGAGGTTGTTCCCTCTTTAGCTCGAGCTAAAGAGGGAACAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-557s21c1
Sequence:CCGGTGGAAACAAAGTCCAACATATCTCGAGATATGTTGGACTTTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-339s21c1
Sequence:CCGGACTGTTGTCAAGACGGATTATCTCGAGATAATCCGTCTTGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-273s21c1
Sequence:CCGGGGCAAAGCCAGAACTCTATTTCTCGAGAAATAGAGTTCTGGCTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023538.1-1493s21c1
Sequence:CCGGTTGTGGTCAGTACCCTGTTAACTCGAGTTAACAGGGTACTGACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023538
VALIDATED
AGK MISSION shRNA Lentiviral Transduction Particles
acylglycerol kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-219s1c1
Sequence:CCGGCCCAATGCACAAGTGAAGAAACTCGAGTTTCTTCACTTGTGCATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-438s1c1
Sequence:CCGGCAGGAGGTTGTTACTGGAGTACTCGAGTACTCCAGTAACAACCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-545s1c1
Sequence:CCGGCTTTGCTGAAAGTGGAAACAACTCGAGTTGTTTCCACTTTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023538.1-868s1c1
Sequence:CCGGCGTCTCTGTATAGGAGAATATCTCGAGATATTCTCCTATACAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023538.1-1019s1c1
Sequence:CCGGCCTGATGAGCAAAGAGGATTTCTCGAGAAATCCTCTTTGCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023538.1-1812s21c1
Sequence:CCGGGTGAGGTTGTTCCCTCTTTAGCTCGAGCTAAAGAGGGAACAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-557s21c1
Sequence:CCGGTGGAAACAAAGTCCAACATATCTCGAGATATGTTGGACTTTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-339s21c1
Sequence:CCGGACTGTTGTCAAGACGGATTATCTCGAGATAATCCGTCTTGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023538.1-273s21c1
Sequence:CCGGGGCAAAGCCAGAACTCTATTTCTCGAGAAATAGAGTTCTGGCTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023538.1-1493s21c1
Sequence:CCGGTTGTGGTCAGTACCCTGTTAACTCGAGTTAACAGGGTACTGACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018238
VALIDATED
AGK MISSION shRNA Bacterial Glycerol Stock
acylglycerol kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018238.2-158s1c1
Sequence:CCGGGAAGCTCAGGTGTTTGGCAATCTCGAGATTGCCAAACACCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018238.2-951s1c1
Sequence:CCGGCCACCATTGAACTGTCCATCACTCGAGTGATGGACAGTTCAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-457s1c1
Sequence:CCGGCAGTAAGATTCCCATTGGATTCTCGAGAATCCAATGGGAATCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-1938s1c1
Sequence:CCGGCCCAAACCTAATAACCCAAATCTCGAGATTTGGGTTATTAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018238.2-1634s1c1
Sequence:CCGGGCCCTTCCATTTCTCTTCTTTCTCGAGAAAGAAGAGAAATGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-954s1c1
Sequence:CCGGCCATTGAACTGTCCATCACAACTCGAGTTGTGATGGACAGTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-2031s1c1
Sequence:CCGGCCTCAACTGTACTTGGAGAAACTCGAGTTTCTCCAAGTACAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018238.3-2489s21c1
Sequence:CCGGAGCTAGTTCTTTAGTAGTTAACTCGAGTTAACTACTAAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-606s21c1
Sequence:CCGGTAAGATTCCCATTGGATTTATCTCGAGATAAATCCAATGGGAATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-675s21c1
Sequence:CCGGTGGAAACAAAGTCCAACATATCTCGAGATATGTTGGACTTTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-1111s21c1
Sequence:CCGGTCCATCACAACACGGAATAATCTCGAGATTATTCCGTGTTGTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018238.3-1189s21c1
Sequence:CCGGATCAGCAAAGGAGACTTTATACTCGAGTATAAAGTCTCCTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-1666s21c1
Sequence:CCGGCCCTCCTAAACACGGACTTTCCTCGAGGAAAGTCCGTGTTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-812s21c1
Sequence:CCGGTCAGAGATGCTGGCGTCAAAGCTCGAGCTTTGACGCCAGCATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-913s21c1
Sequence:CCGGCATCAAGCCTCTATCTCATACCTCGAGGTATGAGATAGAGGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018238
VALIDATED
AGK MISSION shRNA shRNA Plasmid DNA
acylglycerol kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018238.2-158s1c1
Sequence:CCGGGAAGCTCAGGTGTTTGGCAATCTCGAGATTGCCAAACACCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018238.2-951s1c1
Sequence:CCGGCCACCATTGAACTGTCCATCACTCGAGTGATGGACAGTTCAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-457s1c1
Sequence:CCGGCAGTAAGATTCCCATTGGATTCTCGAGAATCCAATGGGAATCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-1938s1c1
Sequence:CCGGCCCAAACCTAATAACCCAAATCTCGAGATTTGGGTTATTAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018238.2-1634s1c1
Sequence:CCGGGCCCTTCCATTTCTCTTCTTTCTCGAGAAAGAAGAGAAATGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-954s1c1
Sequence:CCGGCCATTGAACTGTCCATCACAACTCGAGTTGTGATGGACAGTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-2031s1c1
Sequence:CCGGCCTCAACTGTACTTGGAGAAACTCGAGTTTCTCCAAGTACAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018238.3-2489s21c1
Sequence:CCGGAGCTAGTTCTTTAGTAGTTAACTCGAGTTAACTACTAAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-606s21c1
Sequence:CCGGTAAGATTCCCATTGGATTTATCTCGAGATAAATCCAATGGGAATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-675s21c1
Sequence:CCGGTGGAAACAAAGTCCAACATATCTCGAGATATGTTGGACTTTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-1111s21c1
Sequence:CCGGTCCATCACAACACGGAATAATCTCGAGATTATTCCGTGTTGTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018238.3-1189s21c1
Sequence:CCGGATCAGCAAAGGAGACTTTATACTCGAGTATAAAGTCTCCTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-1666s21c1
Sequence:CCGGCCCTCCTAAACACGGACTTTCCTCGAGGAAAGTCCGTGTTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-812s21c1
Sequence:CCGGTCAGAGATGCTGGCGTCAAAGCTCGAGCTTTGACGCCAGCATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-913s21c1
Sequence:CCGGCATCAAGCCTCTATCTCATACCTCGAGGTATGAGATAGAGGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018238
VALIDATED
AGK MISSION shRNA Lentiviral Transduction Particles
acylglycerol kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018238.2-158s1c1
Sequence:CCGGGAAGCTCAGGTGTTTGGCAATCTCGAGATTGCCAAACACCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018238.2-951s1c1
Sequence:CCGGCCACCATTGAACTGTCCATCACTCGAGTGATGGACAGTTCAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-457s1c1
Sequence:CCGGCAGTAAGATTCCCATTGGATTCTCGAGAATCCAATGGGAATCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-1938s1c1
Sequence:CCGGCCCAAACCTAATAACCCAAATCTCGAGATTTGGGTTATTAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018238.2-1634s1c1
Sequence:CCGGGCCCTTCCATTTCTCTTCTTTCTCGAGAAAGAAGAGAAATGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-954s1c1
Sequence:CCGGCCATTGAACTGTCCATCACAACTCGAGTTGTGATGGACAGTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018238.2-2031s1c1
Sequence:CCGGCCTCAACTGTACTTGGAGAAACTCGAGTTTCTCCAAGTACAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018238.3-2489s21c1
Sequence:CCGGAGCTAGTTCTTTAGTAGTTAACTCGAGTTAACTACTAAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-606s21c1
Sequence:CCGGTAAGATTCCCATTGGATTTATCTCGAGATAAATCCAATGGGAATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-675s21c1
Sequence:CCGGTGGAAACAAAGTCCAACATATCTCGAGATATGTTGGACTTTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-1111s21c1
Sequence:CCGGTCCATCACAACACGGAATAATCTCGAGATTATTCCGTGTTGTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018238.3-1189s21c1
Sequence:CCGGATCAGCAAAGGAGACTTTATACTCGAGTATAAAGTCTCCTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-1666s21c1
Sequence:CCGGCCCTCCTAAACACGGACTTTCCTCGAGGAAAGTCCGTGTTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-812s21c1
Sequence:CCGGTCAGAGATGCTGGCGTCAAAGCTCGAGCTTTGACGCCAGCATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018238.3-913s21c1
Sequence:CCGGCATCAAGCCTCTATCTCATACCTCGAGGTATGAGATAGAGGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks