EMAIL THIS PAGE TO A FRIEND

AGL

amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase

253 Gene Product Result for
Synonyms: GDE
Gene ID:
Human(178) Summary: This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(77559) amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Rat(362029) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
fruit fly(250481) angle winglike
cow(517397) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Horse(100050695) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
domestic cat(101086077) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
dog(479931) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
chicken(424474) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
sheep(101111501) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Domestic Rabbit(100009066) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
domestic guinea pig(100721296) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
naked mole-rat(101717426) amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000028 Rosetta Predictions human pricing
NM_000642 Rosetta Predictions human pricing
NM_000643 Rosetta Predictions human pricing
NM_000644 Rosetta Predictions human pricing
NM_000645 Rosetta Predictions human pricing
NM_000646 Rosetta Predictions human pricing
NM_001108564 Rosetta Predictions rat pricing
NM_001081326 Rosetta Predictions mouse pricing
XM_131166 Rosetta Predictions mouse pricing
XM_894172 Rosetta Predictions mouse pricing
XM_901327 Rosetta Predictions mouse pricing
XM_901340 Rosetta Predictions mouse pricing
XM_901350 Rosetta Predictions mouse pricing
XM_901354 Rosetta Predictions mouse pricing
XM_901357 Rosetta Predictions mouse pricing
XM_901359 Rosetta Predictions mouse pricing
XM_901363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301694 predicted 3911
2 SASI_Hs02_00301695 predicted 2399
3 SASI_Hs01_00044357 predicted 1848
4 SASI_Hs01_00044359 predicted 2022
5 SASI_Hs01_00044360 predicted 2238
6 SASI_Hs01_00044361 predicted 3656
7 SASI_Hs01_00044365 predicted 3946
8 SASI_Hs01_00044366 predicted 1308
9 SASI_Hs02_00301696 predicted 1458
10 SASI_Hs02_00301697 predicted 968
11 SASI_Hs01_00044358 predicted 1138
12 SASI_Hs01_00044362 predicted 2640
13 SASI_Hs01_00044363 predicted 1573
14 SASI_Hs01_00044364 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302998 predicted 3831
2 SASI_Hs02_00302999 predicted 2317
3 SASI_Hs01_00075084 predicted 1769
4 SASI_Hs01_00075086 predicted 1947
5 SASI_Hs01_00075087 predicted 2168
6 SASI_Hs01_00075088 predicted 3584
7 SASI_Hs01_00075092 predicted 3867
8 SASI_Hs01_00075093 predicted 1229
9 SASI_Hs02_00303000 predicted 1377
10 SASI_Hs02_00303001 predicted 894
11 SASI_Hs01_00075085 predicted 1057
12 SASI_Hs01_00075089 predicted 2559
13 SASI_Hs01_00075090 predicted 1495
14 SASI_Hs01_00075091 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303002 predicted 3632
2 SASI_Hs02_00303003 predicted 2117
3 SASI_Hs01_00237126 predicted 1571
4 SASI_Hs01_00237128 predicted 1744
5 SASI_Hs01_00237129 predicted 1965
6 SASI_Hs01_00237130 predicted 3381
7 SASI_Hs01_00237134 predicted 3668
8 SASI_Hs01_00237135 predicted 1031
9 SASI_Hs02_00303004 predicted 1175
10 SASI_Hs02_00303005 predicted 693
11 SASI_Hs01_00237127 predicted 860
12 SASI_Hs01_00237131 predicted 2359
13 SASI_Hs01_00237132 predicted 1290
14 SASI_Hs01_00237133 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303006 predicted 3570
2 SASI_Hs02_00303007 predicted 2054
3 SASI_Hs01_00126795 predicted 1506
4 SASI_Hs01_00126797 predicted 1682
5 SASI_Hs01_00126798 predicted 1900
6 SASI_Hs01_00126799 predicted 3316
7 SASI_Hs01_00126803 predicted 3604
8 SASI_Hs01_00126804 predicted 969
9 SASI_Hs02_00303008 predicted 1119
10 SASI_Hs02_00303009 predicted 635
11 SASI_Hs01_00126796 predicted 795
12 SASI_Hs01_00126800 predicted 2299
13 SASI_Hs01_00126801 predicted 1232
14 SASI_Hs01_00126802 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303010 predicted 3645
2 SASI_Hs02_00303011 predicted 2126
3 SASI_Hs01_00176360 predicted 1581
4 SASI_Hs01_00176362 predicted 1759
5 SASI_Hs01_00176363 predicted 1979
6 SASI_Hs01_00176364 predicted 3388
7 SASI_Hs01_00176368 predicted 3685
8 SASI_Hs01_00176369 predicted 1044
9 SASI_Hs02_00303012 predicted 1189
10 SASI_Hs02_00303013 predicted 701
11 SASI_Hs01_00176361 predicted 875
12 SASI_Hs01_00176365 predicted 2370
13 SASI_Hs01_00176366 predicted 1304
14 SASI_Hs01_00176367 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303014 predicted 3648
2 SASI_Hs02_00303015 predicted 2127
3 SASI_Hs01_00241236 predicted 1583
4 SASI_Hs01_00241238 predicted 1753
5 SASI_Hs01_00241239 predicted 1976
6 SASI_Hs01_00241240 predicted 3388
7 SASI_Hs01_00241244 predicted 3684
8 SASI_Hs01_00241245 predicted 1045
9 SASI_Hs02_00303016 predicted 1192
10 SASI_Hs02_00303017 predicted 705
11 SASI_Hs01_00241237 predicted 867
12 SASI_Hs01_00241241 predicted 2374
13 SASI_Hs01_00241242 predicted 1303
14 SASI_Hs01_00241243 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239879 predicted 3741
2 SASI_Rn02_00239880 predicted 4999
3 SASI_Rn02_00239881 predicted 3967
4 SASI_Rn02_00239882 predicted 2411
5 SASI_Rn02_00239883 predicted 2172
6 SASI_Rn02_00239884 predicted 3559
7 SASI_Rn02_00239885 predicted 2775
8 SASI_Rn02_00239886 predicted 1963
9 SASI_Rn02_00239887 predicted 3535
10 SASI_Rn02_00239888 predicted 5124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297321 predicted 4663
2 SASI_Mm02_00297322 predicted 1742
3 SASI_Mm02_00297323 predicted 1306
4 SASI_Mm02_00297324 predicted 1829
5 SASI_Mm02_00297325 predicted 2590
6 SASI_Mm02_00297326 predicted 2080
7 SASI_Mm02_00297327 predicted 519
8 SASI_Mm02_00297328 predicted 3625
9 SASI_Mm02_00297329 predicted 2749
10 SASI_Mm02_00297330 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202447 predicted 1942
2 SASI_Mm01_00202448 predicted 1742
3 SASI_Mm01_00202449 predicted 1319
4 SASI_Mm01_00202450 predicted 1838
5 SASI_Mm01_00202451 predicted 2588
6 SASI_Mm01_00202452 predicted 2082
7 SASI_Mm01_00202453 predicted 526
8 SASI_Mm01_00202454 predicted 3639
9 SASI_Mm01_00202455 predicted 2750
10 SASI_Mm01_00202456 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213146 predicted 1948
2 SASI_Mm01_00213147 predicted 4664
3 SASI_Mm01_00213148 predicted 1746
4 SASI_Mm01_00213149 predicted 1318
5 SASI_Mm01_00213150 predicted 1837
6 SASI_Mm01_00213151 predicted 2588
7 SASI_Mm01_00213152 predicted 2080
8 SASI_Mm01_00213153 predicted 529
9 SASI_Mm01_00213154 predicted 3636
10 SASI_Mm01_00213155 predicted 2750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273958 predicted 799
2 SASI_Mm01_00273959 predicted 3522
3 SASI_Mm01_00273960 predicted 699
4 SASI_Mm01_00273961 predicted 1546
5 SASI_Mm01_00273962 predicted 1445
6 SASI_Mm01_00273963 predicted 939
7 SASI_Mm01_00273964 predicted 2496
8 SASI_Mm01_00273965 predicted 2076
9 SASI_Mm01_00273966 predicted 2139
10 SASI_Mm01_00273967 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268293 predicted 903
2 SASI_Mm01_00268294 predicted 1071
3 SASI_Mm01_00268295 predicted 1084
4 SASI_Mm01_00268296 predicted 1334
5 SASI_Mm01_00268297 predicted 999
6 SASI_Mm01_00268298 predicted 1346
7 SASI_Mm01_00268299 predicted 1036
8 SASI_Mm01_00268300 predicted 1319
9 SASI_Mm01_00268301 predicted 960
10 SASI_Mm01_00268302 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255370 predicted 2069
2 SASI_Mm01_00255371 predicted 4799
3 SASI_Mm01_00255372 predicted 1444
4 SASI_Mm01_00255373 predicted 1966
5 SASI_Mm01_00255374 predicted 2715
6 SASI_Mm01_00255375 predicted 2215
7 SASI_Mm01_00255376 predicted 651
8 SASI_Mm01_00255377 predicted 3760
9 SASI_Mm01_00255378 predicted 2884
10 SASI_Mm01_00255379 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285997 predicted 1941
2 SASI_Mm01_00285998 predicted 1742
3 SASI_Mm01_00285999 predicted 1320
4 SASI_Mm01_00286000 predicted 1844
5 SASI_Mm01_00286001 predicted 2587
6 SASI_Mm01_00286002 predicted 2090
7 SASI_Mm01_00286003 predicted 521
8 SASI_Mm01_00286004 predicted 3638
9 SASI_Mm01_00286005 predicted 2749
10 SASI_Mm01_00286006 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266793 predicted 876
2 SASI_Mm01_00266794 predicted 662
3 SASI_Mm01_00266795 predicted 522
4 SASI_Mm01_00266796 predicted 485
5 SASI_Mm01_00266797 predicted 588
6 SASI_Mm01_00266798 predicted 669
7 SASI_Mm01_00266799 predicted 759
8 SASI_Mm01_00266800 predicted 311
9 SASI_Mm01_00266801 predicted 559
10 SASI_Mm01_00266802 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278757 predicted 1943
2 SASI_Mm01_00278758 predicted 1746
3 SASI_Mm01_00278759 predicted 1320
4 SASI_Mm01_00278760 predicted 1843
5 SASI_Mm01_00278761 predicted 2083
6 SASI_Mm01_00278762 predicted 522
7 SASI_Mm01_00278763 predicted 1299
8 SASI_Mm01_00278764 predicted 2611
9 SASI_Mm01_00278765 predicted 1090
10 SASI_Mm01_00278766 predicted 2390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269448 predicted 2003
2 SASI_Mm01_00269449 predicted 4733
3 SASI_Mm01_00269450 predicted 1805
4 SASI_Mm01_00269451 predicted 1896
5 SASI_Mm01_00269452 predicted 2650
6 SASI_Mm01_00269453 predicted 2148
7 SASI_Mm01_00269454 predicted 3691
8 SASI_Mm01_00269455 predicted 3279
9 SASI_Mm01_00269456 predicted 3340
10 SASI_Mm01_00269457 predicted 2810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000028
VALIDATED
AGL MISSION shRNA Bacterial Glycerol Stock
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000028.2-4600s21c1
Sequence:CCGGCTATCAGCTCAGGCCTAATTTCTCGAGAAATTAGGCCTGAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000028.2-1169s21c1
Sequence:CCGGCATCCAGAATGTGCCTATAATCTCGAGATTATAGGCACATTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000028.2-5487s21c1
Sequence:CCGGATATTAACACCACGTACTATACTCGAGTATAGTACGTGGTGTTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000028.1-3266s1c1
Sequence:CCGGGCCCTTAAATATGCAGGTCTTCTCGAGAAGACCTGCATATTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000028.1-999s1c1
Sequence:CCGGCCCTTGCCAATCAGTTAGAATCTCGAGATTCTAACTGATTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_000028.1-5045s1c1
Sequence:CCGGGCTACTATTCTTGAGACACTTCTCGAGAAGTGTCTCAAGAATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000028.1-3825s1c1
Sequence:CCGGGCTATGTAGAAGCCAGGAATACTCGAGTATTCCTGGCTTCTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000028.1-1899s1c1
Sequence:CCGGCGGGTTCAGAAGTTTACCTAACTCGAGTTAGGTAAACTTCTGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000028
VALIDATED
AGL MISSION shRNA shRNA Plasmid DNA
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000028.2-4600s21c1
Sequence:CCGGCTATCAGCTCAGGCCTAATTTCTCGAGAAATTAGGCCTGAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000028.2-1169s21c1
Sequence:CCGGCATCCAGAATGTGCCTATAATCTCGAGATTATAGGCACATTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000028.2-5487s21c1
Sequence:CCGGATATTAACACCACGTACTATACTCGAGTATAGTACGTGGTGTTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000028.1-3266s1c1
Sequence:CCGGGCCCTTAAATATGCAGGTCTTCTCGAGAAGACCTGCATATTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000028.1-999s1c1
Sequence:CCGGCCCTTGCCAATCAGTTAGAATCTCGAGATTCTAACTGATTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_000028.1-5045s1c1
Sequence:CCGGGCTACTATTCTTGAGACACTTCTCGAGAAGTGTCTCAAGAATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000028.1-3825s1c1
Sequence:CCGGGCTATGTAGAAGCCAGGAATACTCGAGTATTCCTGGCTTCTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000028.1-1899s1c1
Sequence:CCGGCGGGTTCAGAAGTTTACCTAACTCGAGTTAGGTAAACTTCTGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000028
VALIDATED
AGL MISSION shRNA Lentiviral Transduction Particles
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000028.2-4600s21c1
Sequence:CCGGCTATCAGCTCAGGCCTAATTTCTCGAGAAATTAGGCCTGAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000028.2-1169s21c1
Sequence:CCGGCATCCAGAATGTGCCTATAATCTCGAGATTATAGGCACATTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000028.2-5487s21c1
Sequence:CCGGATATTAACACCACGTACTATACTCGAGTATAGTACGTGGTGTTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000028.1-3266s1c1
Sequence:CCGGGCCCTTAAATATGCAGGTCTTCTCGAGAAGACCTGCATATTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000028.1-999s1c1
Sequence:CCGGCCCTTGCCAATCAGTTAGAATCTCGAGATTCTAACTGATTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_000028.1-5045s1c1
Sequence:CCGGGCTACTATTCTTGAGACACTTCTCGAGAAGTGTCTCAAGAATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000028.1-3825s1c1
Sequence:CCGGGCTATGTAGAAGCCAGGAATACTCGAGTATTCCTGGCTTCTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000028.1-1899s1c1
Sequence:CCGGCGGGTTCAGAAGTTTACCTAACTCGAGTTAGGTAAACTTCTGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081326
VALIDATED
AGL MISSION shRNA Bacterial Glycerol Stock
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-3113s21c1
Sequence:CCGGACGTGAGTGGTCGGCTTATTTCTCGAGAAATAAGCCGACCACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-3219s21c1
Sequence:CCGGCTGCTACTTTGACGCTATATTCTCGAGAATATAGCGTCAAAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-304s21c1
Sequence:CCGGTTCCGATTAGGCCCAACTTTACTCGAGTAAAGTTGGGCCTAATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-2851s21c1
Sequence:CCGGGACAACGCAGATCCTATATTACTCGAGTAATATAGGATCTGCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-7964s21c1
Sequence:CCGGCACGCTCGGTGTGCTAATTAACTCGAGTTAATTAGCACACCGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081326
VALIDATED
AGL MISSION shRNA shRNA Plasmid DNA
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-3113s21c1
Sequence:CCGGACGTGAGTGGTCGGCTTATTTCTCGAGAAATAAGCCGACCACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-3219s21c1
Sequence:CCGGCTGCTACTTTGACGCTATATTCTCGAGAATATAGCGTCAAAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-304s21c1
Sequence:CCGGTTCCGATTAGGCCCAACTTTACTCGAGTAAAGTTGGGCCTAATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-2851s21c1
Sequence:CCGGGACAACGCAGATCCTATATTACTCGAGTAATATAGGATCTGCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-7964s21c1
Sequence:CCGGCACGCTCGGTGTGCTAATTAACTCGAGTTAATTAGCACACCGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081326
VALIDATED
AGL MISSION shRNA Lentiviral Transduction Particles
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-3113s21c1
Sequence:CCGGACGTGAGTGGTCGGCTTATTTCTCGAGAAATAAGCCGACCACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-3219s21c1
Sequence:CCGGCTGCTACTTTGACGCTATATTCTCGAGAATATAGCGTCAAAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-304s21c1
Sequence:CCGGTTCCGATTAGGCCCAACTTTACTCGAGTAAAGTTGGGCCTAATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-2851s21c1
Sequence:CCGGGACAACGCAGATCCTATATTACTCGAGTAATATAGGATCTGCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081326.1-7964s21c1
Sequence:CCGGCACGCTCGGTGTGCTAATTAACTCGAGTTAATTAGCACACCGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks