EMAIL THIS PAGE TO A FRIEND

AGMAT

agmatine ureohydrolase (agmatinase)

69 Gene Product Result for
UniProtKB ID: Q9BSE5, Q5TDH1, Q9H5J3
Gene ID:
Mouse(75986) agmatine ureohydrolase (agmatinase)
Rat(298607) agmatine ureohydrolase (agmatinase)
Zebrafish(556522) agmatine ureohydrolase (agmatinase)
cow(514509) agmatine ureohydrolase (agmatinase)
domestic cat(101083692) agmatine ureohydrolase (agmatinase)
chicken(373942) agmatine ureohydrolase (agmatinase)
dog(487430) agmatine ureohydrolase (agmatinase)
naked mole-rat(101705780) agmatine ureohydrolase (agmatinase)
domestic guinea pig(100714678) agmatine ureohydrolase (agmatinase)
sheep(101110431) agmatine ureohydrolase (agmatinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024758 Rosetta Predictions human pricing
NM_001048185 Rosetta Predictions rat pricing
NM_001081408 Rosetta Predictions mouse pricing
XM_980293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107320 predicted 508
2 SASI_Hs01_00107321 predicted 1081
3 SASI_Hs01_00107322 predicted 516
4 SASI_Hs01_00107323 predicted 597
5 SASI_Hs01_00107324 predicted 1105
6 SASI_Hs01_00107325 predicted 935
7 SASI_Hs01_00107326 predicted 1149
8 SASI_Hs01_00107327 predicted 1008
9 SASI_Hs02_00357260 predicted 1153
10 SASI_Hs01_00107329 predicted 824
11 SASI_Hs01_00107328 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207402 predicted 488
2 SASI_Rn02_00207403 predicted 455
3 SASI_Rn02_00207404 predicted 981
4 SASI_Rn02_00207405 predicted 443
5 SASI_Rn02_00207406 predicted 1020
6 SASI_Rn02_00207407 predicted 385
7 SASI_Rn02_00207408 predicted 958
8 SASI_Rn02_00207409 predicted 569
9 SASI_Rn02_00207410 predicted 393
10 SASI_Rn02_00207411 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298091 predicted 1157
2 SASI_Mm02_00298092 predicted 1002
3 SASI_Mm02_00298093 predicted 1113
4 SASI_Mm02_00298094 predicted 525
5 SASI_Mm02_00298095 predicted 957
6 SASI_Mm02_00298096 predicted 739
7 SASI_Mm02_00298097 predicted 673
8 SASI_Mm02_00298098 predicted 624
9 SASI_Mm02_00298099 predicted 768
10 SASI_Mm02_00298100 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247763 predicted 430
2 SASI_Mm01_00247764 predicted 558
3 SASI_Mm01_00247765 predicted 522
4 SASI_Mm01_00247766 predicted 508
5 SASI_Mm01_00247767 predicted 518
6 SASI_Mm01_00247768 predicted 310
7 SASI_Mm01_00247769 predicted 445
8 SASI_Mm01_00247770 predicted 221
9 SASI_Mm01_00247771 predicted 387
10 SASI_Mm01_00247772 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024758
VALIDATED
AGMAT MISSION shRNA Bacterial Glycerol Stock
agmatine ureohydrolase (agmatinase)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-518s1c1
Sequence:CCGGCGATGTGAATGTCAATCTTTACTCGAGTAAAGATTGACATTCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-947s1c1
Sequence:CCGGCAAACCCATTTATATCAGCTTCTCGAGAAGCTGATATAAATGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-1098s1c1
Sequence:CCGGGTCGAAGTTTCACCACCGTATCTCGAGATACGGTGGTGAAACTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_024758.3-643s1c1
Sequence:CCGGCCATATTGCAAGCGATGGCAACTCGAGTTGCCATCGCTTGCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-435s1c1
Sequence:CCGGCGGGAAGAATCAGTGATGCTTCTCGAGAAGCATCACTGATTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-899s21c1
Sequence:CCGGGAAGTCGCTGGTTCCTCTGATCTCGAGATCAGAGGAACCAGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-971s21c1
Sequence:CCGGTATTGACGCTCTGGATCCTGCCTCGAGGCAGGATCCAGAGCGTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-621s21c1
Sequence:CCGGGGAGATCACACAATCACATATCTCGAGATATGTGATTGTGTGATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1002s21c1
Sequence:CCGGGGGACAGGGACACCTGAAATTCTCGAGAATTTCAGGTGTCCCTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1187s21c1
Sequence:CCGGAGTGACAACCGTCTGAGTCTTCTCGAGAAGACTCAGACGGTTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1155s21c1
Sequence:CCGGCTGCTGTTTGAGATGCTATGTCTCGAGACATAGCATCTCAAACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024758
VALIDATED
AGMAT MISSION shRNA shRNA Plasmid DNA
agmatine ureohydrolase (agmatinase)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-518s1c1
Sequence:CCGGCGATGTGAATGTCAATCTTTACTCGAGTAAAGATTGACATTCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-947s1c1
Sequence:CCGGCAAACCCATTTATATCAGCTTCTCGAGAAGCTGATATAAATGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-1098s1c1
Sequence:CCGGGTCGAAGTTTCACCACCGTATCTCGAGATACGGTGGTGAAACTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_024758.3-643s1c1
Sequence:CCGGCCATATTGCAAGCGATGGCAACTCGAGTTGCCATCGCTTGCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-435s1c1
Sequence:CCGGCGGGAAGAATCAGTGATGCTTCTCGAGAAGCATCACTGATTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-899s21c1
Sequence:CCGGGAAGTCGCTGGTTCCTCTGATCTCGAGATCAGAGGAACCAGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-971s21c1
Sequence:CCGGTATTGACGCTCTGGATCCTGCCTCGAGGCAGGATCCAGAGCGTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-621s21c1
Sequence:CCGGGGAGATCACACAATCACATATCTCGAGATATGTGATTGTGTGATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1002s21c1
Sequence:CCGGGGGACAGGGACACCTGAAATTCTCGAGAATTTCAGGTGTCCCTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1187s21c1
Sequence:CCGGAGTGACAACCGTCTGAGTCTTCTCGAGAAGACTCAGACGGTTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1155s21c1
Sequence:CCGGCTGCTGTTTGAGATGCTATGTCTCGAGACATAGCATCTCAAACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024758
VALIDATED
AGMAT MISSION shRNA Lentiviral Transduction Particles
agmatine ureohydrolase (agmatinase)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-518s1c1
Sequence:CCGGCGATGTGAATGTCAATCTTTACTCGAGTAAAGATTGACATTCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-947s1c1
Sequence:CCGGCAAACCCATTTATATCAGCTTCTCGAGAAGCTGATATAAATGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-1098s1c1
Sequence:CCGGGTCGAAGTTTCACCACCGTATCTCGAGATACGGTGGTGAAACTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_024758.3-643s1c1
Sequence:CCGGCCATATTGCAAGCGATGGCAACTCGAGTTGCCATCGCTTGCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024758.3-435s1c1
Sequence:CCGGCGGGAAGAATCAGTGATGCTTCTCGAGAAGCATCACTGATTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-899s21c1
Sequence:CCGGGAAGTCGCTGGTTCCTCTGATCTCGAGATCAGAGGAACCAGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-971s21c1
Sequence:CCGGTATTGACGCTCTGGATCCTGCCTCGAGGCAGGATCCAGAGCGTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-621s21c1
Sequence:CCGGGGAGATCACACAATCACATATCTCGAGATATGTGATTGTGTGATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1002s21c1
Sequence:CCGGGGGACAGGGACACCTGAAATTCTCGAGAATTTCAGGTGTCCCTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1187s21c1
Sequence:CCGGAGTGACAACCGTCTGAGTCTTCTCGAGAAGACTCAGACGGTTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024758.3-1155s21c1
Sequence:CCGGCTGCTGTTTGAGATGCTATGTCTCGAGACATAGCATCTCAAACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081408
AGMAT MISSION shRNA Bacterial Glycerol Stock
agmatine ureohydrolase (agmatinase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-1011s21c1
Sequence:CCGGAGGAACAGGGACACCGGAAATCTCGAGATTTCCGGTGTCCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-713s21c1
Sequence:CCGGACACCAACACCACGGACAAACCTCGAGGTTTGTCCGTGGTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-524s21c1
Sequence:CCGGTAGGCAATGTGAACGTCAATCCTCGAGGATTGACGTTCACATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-631s21c1
Sequence:CCGGGGAGACCAAACAATCACATATCTCGAGATATGTGATTGTTTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081408.1-1213s21c1
Sequence:CCGGGTCTGTGTTCCTGAAGACAAACTCGAGTTTGTCTTCAGGAACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081408
AGMAT MISSION shRNA shRNA Plasmid DNA
agmatine ureohydrolase (agmatinase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-1011s21c1
Sequence:CCGGAGGAACAGGGACACCGGAAATCTCGAGATTTCCGGTGTCCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-713s21c1
Sequence:CCGGACACCAACACCACGGACAAACCTCGAGGTTTGTCCGTGGTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-524s21c1
Sequence:CCGGTAGGCAATGTGAACGTCAATCCTCGAGGATTGACGTTCACATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-631s21c1
Sequence:CCGGGGAGACCAAACAATCACATATCTCGAGATATGTGATTGTTTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081408.1-1213s21c1
Sequence:CCGGGTCTGTGTTCCTGAAGACAAACTCGAGTTTGTCTTCAGGAACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081408
AGMAT MISSION shRNA Lentiviral Transduction Particles
agmatine ureohydrolase (agmatinase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-1011s21c1
Sequence:CCGGAGGAACAGGGACACCGGAAATCTCGAGATTTCCGGTGTCCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-713s21c1
Sequence:CCGGACACCAACACCACGGACAAACCTCGAGGTTTGTCCGTGGTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-524s21c1
Sequence:CCGGTAGGCAATGTGAACGTCAATCCTCGAGGATTGACGTTCACATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081408.1-631s21c1
Sequence:CCGGGGAGACCAAACAATCACATATCTCGAGATATGTGATTGTTTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081408.1-1213s21c1
Sequence:CCGGGTCTGTGTTCCTGAAGACAAACTCGAGTTTGTCTTCAGGAACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks