EMAIL THIS PAGE TO A FRIEND

AGMO

alkylglycerol monooxygenase

96 Gene Product Result for
Synonyms: TMEM195
UniProtKB ID: Q6ZNB7, A4D114, A6NCH5
Gene ID:
Human(392636) Summary: The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Mouse(319660) alkylglycerol monooxygenase
Rat(362732) alkylglycerol monooxygenase
sheep(101103313) alkylglycerol monooxygenase
Domestic Rabbit(100339522) alkylglycerol monooxygenase
Zebrafish(405819) alkylglycerol monooxygenase
cow(613658) alkylglycerol monooxygenase
Horse(100052771) alkylglycerol monooxygenase
domestic cat(101082991) alkylglycerol monooxygenase
dog(475247) alkylglycerol monooxygenase
chicken(772374) alkylglycerol monooxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_374406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022831 MISSION® esiRNA esiRNA human TMEM195 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004320 Rosetta Predictions human pricing
XM_001077290 Rosetta Predictions rat pricing
XM_343054 Rosetta Predictions rat pricing
NM_178767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155029 predicted 977
2 SASI_Hs01_00155030 predicted 438
3 SASI_Hs01_00155031 predicted 532
4 SASI_Hs01_00155032 predicted 367
5 SASI_Hs01_00155033 predicted 1335
6 SASI_Hs01_00155034 predicted 384
7 SASI_Hs01_00155035 predicted 330
8 SASI_Hs02_00304538 predicted 825
9 SASI_Hs01_00155036 predicted 1130
10 SASI_Hs01_00155037 predicted 1342
11 SASI_Hs01_00155038 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356558 predicted 580
2 SASI_Rn02_00356559 predicted 488
3 SASI_Rn02_00356560 predicted 501
4 SASI_Rn02_00356561 predicted 1187
5 SASI_Rn02_00356562 predicted 326
6 SASI_Rn02_00356563 predicted 950
7 SASI_Rn02_00356564 predicted 220
8 SASI_Rn02_00356565 predicted 1076
9 SASI_Rn02_00356566 predicted 999
10 SASI_Rn02_00356567 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395221 predicted 1097
2 SASI_Rn02_00395222 predicted 1116
3 SASI_Rn02_00395223 predicted 1107
4 SASI_Rn02_00395224 predicted 1067
5 SASI_Rn02_00395225 predicted 997
6 SASI_Rn02_00395226 predicted 1079
7 SASI_Rn02_00395227 predicted 992
8 SASI_Rn02_00395228 predicted 1118
9 SASI_Rn02_00395229 predicted 1150
10 SASI_Rn02_00395230 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044884 predicted 668
2 SASI_Mm02_00349332 predicted 1830
3 SASI_Mm01_00044887 predicted 892
4 SASI_Mm02_00349333 predicted 1808
5 SASI_Mm02_00349334 predicted 1607
6 SASI_Mm01_00044889 predicted 766
7 SASI_Mm01_00044891 predicted 1153
8 SASI_Mm02_00349335 predicted 1343
9 SASI_Mm02_00349336 predicted 1593
10 SASI_Mm02_00349337 predicted 1036
11 SASI_Mm01_00044883 predicted 1083
12 SASI_Mm01_00044885 predicted 545
13 SASI_Mm01_00044886 predicted 357
14 SASI_Mm01_00044888 predicted 764
15 SASI_Mm01_00044890 predicted 1126
16 SASI_Mm01_00044892 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004320
AGMO MISSION shRNA Bacterial Glycerol Stock
alkylglycerol monooxygenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004320.1-1355s1c1
Sequence:CCGGCCGTTGCTTGATGTTCTTAATCTCGAGATTAAGAACATCAAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004320.1-2268s1c1
Sequence:CCGGCGAGACTCCGTCTCAAAGAAACTCGAGTTTCTTTGAGACGGAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004320.1-1926s1c1
Sequence:CCGGGTCTTCCTAAGGCCACAGTTACTCGAGTAACTGTGGCCTTAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-1409s1c1
Sequence:CCGGCCCTTCATTGTCATCTGCTTTCTCGAGAAAGCAGATGACAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-210s1c1
Sequence:CCGGCAGGGATTTCGCATGTTGTTTCTCGAGAAACAACATGCGAAATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004320.1-442s1c1
Sequence:CCGGGCATTGAACTGACCAGTTATACTCGAGTATAACTGGTCAGTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-1339s1c1
Sequence:CCGGCTATTATGGAAACTCTCCGTTCTCGAGAACGGAGAGTTTCCATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004320.1-1941s1c1
Sequence:CCGGCAGTTACCTTTGCAATCCATACTCGAGTATGGATTGCAAAGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004320
AGMO MISSION shRNA shRNA Plasmid DNA
alkylglycerol monooxygenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004320.1-1355s1c1
Sequence:CCGGCCGTTGCTTGATGTTCTTAATCTCGAGATTAAGAACATCAAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004320.1-2268s1c1
Sequence:CCGGCGAGACTCCGTCTCAAAGAAACTCGAGTTTCTTTGAGACGGAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004320.1-1926s1c1
Sequence:CCGGGTCTTCCTAAGGCCACAGTTACTCGAGTAACTGTGGCCTTAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-1409s1c1
Sequence:CCGGCCCTTCATTGTCATCTGCTTTCTCGAGAAAGCAGATGACAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-210s1c1
Sequence:CCGGCAGGGATTTCGCATGTTGTTTCTCGAGAAACAACATGCGAAATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004320.1-442s1c1
Sequence:CCGGGCATTGAACTGACCAGTTATACTCGAGTATAACTGGTCAGTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-1339s1c1
Sequence:CCGGCTATTATGGAAACTCTCCGTTCTCGAGAACGGAGAGTTTCCATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004320.1-1941s1c1
Sequence:CCGGCAGTTACCTTTGCAATCCATACTCGAGTATGGATTGCAAAGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004320
AGMO MISSION shRNA Lentiviral Transduction Particles
alkylglycerol monooxygenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004320.1-1355s1c1
Sequence:CCGGCCGTTGCTTGATGTTCTTAATCTCGAGATTAAGAACATCAAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004320.1-2268s1c1
Sequence:CCGGCGAGACTCCGTCTCAAAGAAACTCGAGTTTCTTTGAGACGGAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004320.1-1926s1c1
Sequence:CCGGGTCTTCCTAAGGCCACAGTTACTCGAGTAACTGTGGCCTTAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-1409s1c1
Sequence:CCGGCCCTTCATTGTCATCTGCTTTCTCGAGAAAGCAGATGACAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-210s1c1
Sequence:CCGGCAGGGATTTCGCATGTTGTTTCTCGAGAAACAACATGCGAAATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004320.1-442s1c1
Sequence:CCGGGCATTGAACTGACCAGTTATACTCGAGTATAACTGGTCAGTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004320.1-1339s1c1
Sequence:CCGGCTATTATGGAAACTCTCCGTTCTCGAGAACGGAGAGTTTCCATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004320.1-1941s1c1
Sequence:CCGGCAGTTACCTTTGCAATCCATACTCGAGTATGGATTGCAAAGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374406
AGMO MISSION shRNA Bacterial Glycerol Stock
alkylglycerol monooxygenase
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374406.2-74s1c1
Sequence:CCGGCCAGTGAAACTTCATTCCAAACTCGAGTTTGGAATGAAGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374406.2-1419s1c1
Sequence:CCGGGCAGAAGAATATGTTTCCTATCTCGAGATAGGAAACATATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374406.2-604s1c1
Sequence:CCGGGCTGTTCATCTTCAATTCAATCTCGAGATTGAATTGAAGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374406
AGMO MISSION shRNA shRNA Plasmid DNA
alkylglycerol monooxygenase
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374406.2-74s1c1
Sequence:CCGGCCAGTGAAACTTCATTCCAAACTCGAGTTTGGAATGAAGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374406.2-1419s1c1
Sequence:CCGGGCAGAAGAATATGTTTCCTATCTCGAGATAGGAAACATATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374406.2-604s1c1
Sequence:CCGGGCTGTTCATCTTCAATTCAATCTCGAGATTGAATTGAAGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374406
AGMO MISSION shRNA Lentiviral Transduction Particles
alkylglycerol monooxygenase
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374406.2-74s1c1
Sequence:CCGGCCAGTGAAACTTCATTCCAAACTCGAGTTTGGAATGAAGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374406.2-1419s1c1
Sequence:CCGGGCAGAAGAATATGTTTCCTATCTCGAGATAGGAAACATATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374406.2-604s1c1
Sequence:CCGGGCTGTTCATCTTCAATTCAATCTCGAGATTGAATTGAAGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178767
AGMO MISSION shRNA Bacterial Glycerol Stock
alkylglycerol monooxygenase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178767.2-1848s1c1
Sequence:CCGGGCACAGAACATTGAGACCAAACTCGAGTTTGGTCTCAATGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-1056s1c1
Sequence:CCGGCATTGGTACATTTGAGCCATTCTCGAGAATGGCTCAAATGTACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-537s1c1
Sequence:CCGGCCTTGAAGTGACCAGTTATATCTCGAGATATAACTGGTCACTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-977s1c1
Sequence:CCGGGCACTCTTATTATTTGGGATACTCGAGTATCCCAAATAATAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178767
AGMO MISSION shRNA shRNA Plasmid DNA
alkylglycerol monooxygenase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178767.2-1848s1c1
Sequence:CCGGGCACAGAACATTGAGACCAAACTCGAGTTTGGTCTCAATGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-1056s1c1
Sequence:CCGGCATTGGTACATTTGAGCCATTCTCGAGAATGGCTCAAATGTACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-537s1c1
Sequence:CCGGCCTTGAAGTGACCAGTTATATCTCGAGATATAACTGGTCACTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-977s1c1
Sequence:CCGGGCACTCTTATTATTTGGGATACTCGAGTATCCCAAATAATAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178767
AGMO MISSION shRNA Lentiviral Transduction Particles
alkylglycerol monooxygenase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178767.2-1848s1c1
Sequence:CCGGGCACAGAACATTGAGACCAAACTCGAGTTTGGTCTCAATGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-1056s1c1
Sequence:CCGGCATTGGTACATTTGAGCCATTCTCGAGAATGGCTCAAATGTACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-537s1c1
Sequence:CCGGCCTTGAAGTGACCAGTTATATCTCGAGATATAACTGGTCACTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178767.2-977s1c1
Sequence:CCGGGCACTCTTATTATTTGGGATACTCGAGTATCCCAAATAATAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks