EMAIL THIS PAGE TO A FRIEND

AGO1

argonaute RISC catalytic component 1

350 Gene Product Result for
Synonyms: EIF2C EIF2C1 GERP95 Q99
Species: Human AGO1(26523), Mouse Ago1(236511), Rat Ago1(313594), fruit fly AGO1(36544), Thale Cress AGO1(841262), naked mole-rat Ago1(101715713), domestic guinea pig Ago1(100726664)
UniProtKB ID: Q9UL18, Q5TA57, Q6P4S0
Gene ID:
Human(26523) Summary: This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. [provided by RefSeq, Jul 2008]
Mouse(236511) argonaute RISC catalytic subunit 1
Rat(313594) argonaute RISC catalytic component 1
fruit fly(36544) Argonaute-1
Thale Cress(841262) protein argonaute 1
naked mole-rat(101715713) argonaute RISC catalytic component 1
domestic guinea pig(100726664) argonaute RISC catalytic component 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012199 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042781 MISSION® esiRNA esiRNA human EIF2C1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012199 Rosetta Predictions human pricing
XM_001058138 Rosetta Predictions rat pricing
XM_233544 Rosetta Predictions rat pricing
NM_153403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187486 predicted 1668
2 SASI_Hs01_00187487 predicted 2367
3 SASI_Hs01_00187488 predicted 2433
4 SASI_Hs01_00187489 predicted 1037
5 SASI_Hs01_00187490 predicted 2417
6 SASI_Hs01_00187491 predicted 1306
7 SASI_Hs01_00187492 predicted 379
8 SASI_Hs01_00187493 predicted 2561
9 SASI_Hs01_00187494 predicted 1854
10 SASI_Hs01_00187495 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288705 predicted 1652
2 SASI_Rn02_00288706 predicted 1578
3 SASI_Rn02_00288707 predicted 1327
4 SASI_Rn02_00288708 predicted 2104
5 SASI_Rn02_00288709 predicted 675
6 SASI_Rn02_00288710 predicted 2821
7 SASI_Rn02_00288711 predicted 2463
8 SASI_Rn02_00288712 predicted 616
9 SASI_Rn02_00288713 predicted 2530
10 SASI_Rn02_00288714 predicted 2152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387874 predicted 1724
2 SASI_Rn02_00387875 predicted 1640
3 SASI_Rn02_00387876 predicted 1392
4 SASI_Rn02_00387877 predicted 2173
5 SASI_Rn02_00387878 predicted 741
6 SASI_Rn02_00387879 predicted 2889
7 SASI_Rn02_00387880 predicted 2529
8 SASI_Rn02_00387881 predicted 682
9 SASI_Rn02_00387882 predicted 2595
10 SASI_Rn02_00387883 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179516 predicted 1937
2 SASI_Mm01_00179517 predicted 1183
3 SASI_Mm01_00179518 predicted 2211
4 SASI_Mm01_00179520 predicted 820
5 SASI_Mm01_00179521 predicted 1644
6 SASI_Mm01_00179522 predicted 377
7 SASI_Mm01_00179523 predicted 276
8 SASI_Mm01_00179524 predicted 757
9 SASI_Mm01_00179525 predicted 2093
10 SASI_Mm02_00343187 predicted 2350
11 SASI_Mm01_00179519 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153403
VALIDATED
AGO1 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-1306s1c1
Sequence:CCGGCGCGGGAAACAGTTCTACAATCTCGAGATTGTAGAACTGTTTCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153403.1-2146s1c1
Sequence:CCGGGCTGACAAGAATGAGCGGATTCTCGAGAATCCGCTCATTCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-231s1c1
Sequence:CCGGCCAGCATTTCAAACCGCAGATCTCGAGATCTGCGGTTTGAAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-2221s1c1
Sequence:CCGGCCATTTGAGTTCGACTTCTATCTCGAGATAGAAGTCGAACTCAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-142s1c1
Sequence:CCGGCCTAAGATTGACGTTTACCATCTCGAGATGGTAAACGTCAATCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153403.2-1909s21c1
Sequence:CCGGATTGAAGACTTGTCCTATATGCTCGAGCATATAGGACAAGTCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153403.2-2571s21c1
Sequence:CCGGTTGAAGGCAGAACGCTGTTACCTCGAGGTAACAGCGTTCTGCCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153403
VALIDATED
AGO1 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-1306s1c1
Sequence:CCGGCGCGGGAAACAGTTCTACAATCTCGAGATTGTAGAACTGTTTCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153403.1-2146s1c1
Sequence:CCGGGCTGACAAGAATGAGCGGATTCTCGAGAATCCGCTCATTCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-231s1c1
Sequence:CCGGCCAGCATTTCAAACCGCAGATCTCGAGATCTGCGGTTTGAAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-2221s1c1
Sequence:CCGGCCATTTGAGTTCGACTTCTATCTCGAGATAGAAGTCGAACTCAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-142s1c1
Sequence:CCGGCCTAAGATTGACGTTTACCATCTCGAGATGGTAAACGTCAATCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153403.2-1909s21c1
Sequence:CCGGATTGAAGACTTGTCCTATATGCTCGAGCATATAGGACAAGTCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153403.2-2571s21c1
Sequence:CCGGTTGAAGGCAGAACGCTGTTACCTCGAGGTAACAGCGTTCTGCCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153403
VALIDATED
AGO1 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-1306s1c1
Sequence:CCGGCGCGGGAAACAGTTCTACAATCTCGAGATTGTAGAACTGTTTCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153403.1-2146s1c1
Sequence:CCGGGCTGACAAGAATGAGCGGATTCTCGAGAATCCGCTCATTCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-231s1c1
Sequence:CCGGCCAGCATTTCAAACCGCAGATCTCGAGATCTGCGGTTTGAAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-2221s1c1
Sequence:CCGGCCATTTGAGTTCGACTTCTATCTCGAGATAGAAGTCGAACTCAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153403.1-142s1c1
Sequence:CCGGCCTAAGATTGACGTTTACCATCTCGAGATGGTAAACGTCAATCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153403.2-1909s21c1
Sequence:CCGGATTGAAGACTTGTCCTATATGCTCGAGCATATAGGACAAGTCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153403.2-2571s21c1
Sequence:CCGGTTGAAGGCAGAACGCTGTTACCTCGAGGTAACAGCGTTCTGCCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012199
AGO1 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-1350s1c1
Sequence:CCGGCCTGATGAAGAATGCCAGCTACTCGAGTAGCTGGCATTCTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-2491s1c1
Sequence:CCGGCCATCCCATTACTATGTTCTTCTCGAGAAGAACATAGTAATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-1132s1c1
Sequence:CCGGGCACAGTATTTCAAGCAGAAACTCGAGTTTCTGCTTGAAATACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-2359s1c1
Sequence:CCGGGCTGACAAGAATGAGCGAATTCTCGAGAATTCGCTCATTCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012199.2-6234s1c1
Sequence:CCGGGCACTGTTCTTTGATTGTTTACTCGAGTAAACAATCAAAGAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012199.2-1535s21c1
Sequence:CCGGACAATGGGATTGAGATCAAAGCTCGAGCTTTGATCTCAATCCCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012199.2-319s21c1
Sequence:CCGGATCAAGCTCCTGGCCAATTACCTCGAGGTAATTGGCCAGGAGCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012199
AGO1 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-1350s1c1
Sequence:CCGGCCTGATGAAGAATGCCAGCTACTCGAGTAGCTGGCATTCTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-2491s1c1
Sequence:CCGGCCATCCCATTACTATGTTCTTCTCGAGAAGAACATAGTAATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-1132s1c1
Sequence:CCGGGCACAGTATTTCAAGCAGAAACTCGAGTTTCTGCTTGAAATACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-2359s1c1
Sequence:CCGGGCTGACAAGAATGAGCGAATTCTCGAGAATTCGCTCATTCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012199.2-6234s1c1
Sequence:CCGGGCACTGTTCTTTGATTGTTTACTCGAGTAAACAATCAAAGAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012199.2-1535s21c1
Sequence:CCGGACAATGGGATTGAGATCAAAGCTCGAGCTTTGATCTCAATCCCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012199.2-319s21c1
Sequence:CCGGATCAAGCTCCTGGCCAATTACCTCGAGGTAATTGGCCAGGAGCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012199
AGO1 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-1350s1c1
Sequence:CCGGCCTGATGAAGAATGCCAGCTACTCGAGTAGCTGGCATTCTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-2491s1c1
Sequence:CCGGCCATCCCATTACTATGTTCTTCTCGAGAAGAACATAGTAATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-1132s1c1
Sequence:CCGGGCACAGTATTTCAAGCAGAAACTCGAGTTTCTGCTTGAAATACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012199.2-2359s1c1
Sequence:CCGGGCTGACAAGAATGAGCGAATTCTCGAGAATTCGCTCATTCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012199.2-6234s1c1
Sequence:CCGGGCACTGTTCTTTGATTGTTTACTCGAGTAAACAATCAAAGAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012199.2-1535s21c1
Sequence:CCGGACAATGGGATTGAGATCAAAGCTCGAGCTTTGATCTCAATCCCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012199.2-319s21c1
Sequence:CCGGATCAAGCTCCTGGCCAATTACCTCGAGGTAATTGGCCAGGAGCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks