EMAIL THIS PAGE TO A FRIEND

AGO2

argonaute RISC catalytic component 2

120 Gene Product Result for
Synonyms: EIF2C2 Q10
Species: Human AGO2(27161), Mouse Ago2(239528), Rat Ago2(59117), domestic guinea pig Ago2(100723471), naked mole-rat Ago2(101714223), fruit fly AGO2(39683), Thale Cress AGO2(840016)
UniProtKB ID: Q9UKV8, Q8TCZ5, Q8WV58, Q96ID1
Gene ID:
Human(27161) Summary: This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(239528) argonaute RISC catalytic subunit 2
Rat(59117) argonaute RISC catalytic component 2
domestic guinea pig(100723471) argonaute RISC catalytic component 2
naked mole-rat(101714223) argonaute RISC catalytic component 2
fruit fly(39683) Argonaute 2
Thale Cress(840016) Argonaute family protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA058075 Anti-AGO2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4301150 Anti-AGO2 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry pricing
SAB4200724 Anti-AGO2 antibody, Mouse monoclonal clone AGO2-10, purified from hybridoma cell culture human
immunoprecipitation, western blot pricing
SAB1105296 Anti-EIF2C2 (28-40) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105297 Anti-EIF2C2 (51-64) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1303264 ANTI-EIF2C2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4200275 Anti-EIF2C2/Ago2 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
SAB4200274 Anti-EIF2C2/Ago2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
SAB4800048 Imprint® Monoclonal Anti-Ago antibody produced in mouse clone 2A8, affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, RIP, western blot pricing
WH0027161M1 Monoclonal Anti-EIF2C2 antibody produced in mouse clone 2E12-1C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405034 Monoclonal Anti-EIF2C2 antibody produced in mouse clone 4D1-1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012154 Rosetta Predictions human pricing
NM_021597 Rosetta Predictions rat pricing
NM_153178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161740 predicted 826
2 SASI_Hs02_00343736 predicted 2652
3 SASI_Hs01_00161743 predicted 1541
4 SASI_Hs02_00343737 predicted 2486
5 SASI_Hs01_00161744 predicted 251
6 SASI_Hs01_00161745 predicted 866
7 SASI_Hs01_00161747 predicted 1157
8 SASI_Hs01_00161748 predicted 782
9 SASI_Hs02_00343738 predicted 1178
10 SASI_Hs02_00343739 predicted 1107
11 SASI_Hs01_00161739 predicted 205
12 SASI_Hs01_00161741 predicted 685
13 SASI_Hs01_00161742 predicted 1239
14 SASI_Hs01_00161746 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042572 predicted 1716
2 SASI_Rn01_00042573 predicted 1208
3 SASI_Rn01_00042574 predicted 800
4 SASI_Rn01_00042575 predicted 233
5 SASI_Rn01_00042576 predicted 787
6 SASI_Rn01_00042578 predicted 1195
7 SASI_Rn02_00262642 predicted 2235
8 SASI_Rn01_00042579 predicted 2398
9 SASI_Rn02_00262643 predicted 322
10 SASI_Rn01_00042580 predicted 1979
11 SASI_Rn01_00042577 predicted 1698
12 SASI_Rn01_00042581 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089373 predicted 1224
2 SASI_Mm01_00089374 predicted 798
3 SASI_Mm01_00089375 predicted 1725
4 SASI_Mm01_00089366 predicted 814
5 SASI_Mm02_00343103 predicted 244
6 SASI_Mm01_00089367 predicted 526
7 SASI_Mm02_00343104 predicted 1603
8 SASI_Mm02_00343105 predicted 303
9 SASI_Mm01_00089370 predicted 1209
10 SASI_Mm02_00343106 predicted 773
11 SASI_Mm01_00089368 predicted 859
12 SASI_Mm01_00089369 predicted 721
13 SASI_Mm01_00089371 predicted 2122
14 SASI_Mm01_00089372 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012154
AGO2 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012154.3-792s21c1
Sequence:CCGGACAGATTCCCAAAGGGTAAAGCTCGAGCTTTACCCTTTGGGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012154.3-2717s21c1
Sequence:CCGGATCGAACATGAGACGTCATTGCTCGAGCAATGACGTCTCATGTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012154.3-2912s21c1
Sequence:CCGGCTATGAACTCAGGGCTTTAAACTCGAGTTTAAAGCCCTGAGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-719s1c1
Sequence:CCGGGCACAGCCAGTAATCGAGTTTCTCGAGAAACTCGATTACTGGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-150s1c1
Sequence:CCGGCAATCAAATTACAGGCCAATTCTCGAGAATTGGCCTGTAATTTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-1219s1c1
Sequence:CCGGCGTCCGTGAATTTGGAATCATCTCGAGATGATTCCAAATTCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-1163s1c1
Sequence:CCGGCGGCAAGAAGAGATTAGCAAACTCGAGTTTGCTAATCTCTTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012154.2-2776s1c1
Sequence:CCGGCCAGATTTCAAACTTGGATTTCTCGAGAAATCCAAGTTTGAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012154
AGO2 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012154.3-792s21c1
Sequence:CCGGACAGATTCCCAAAGGGTAAAGCTCGAGCTTTACCCTTTGGGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012154.3-2717s21c1
Sequence:CCGGATCGAACATGAGACGTCATTGCTCGAGCAATGACGTCTCATGTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012154.3-2912s21c1
Sequence:CCGGCTATGAACTCAGGGCTTTAAACTCGAGTTTAAAGCCCTGAGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-719s1c1
Sequence:CCGGGCACAGCCAGTAATCGAGTTTCTCGAGAAACTCGATTACTGGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-150s1c1
Sequence:CCGGCAATCAAATTACAGGCCAATTCTCGAGAATTGGCCTGTAATTTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-1219s1c1
Sequence:CCGGCGTCCGTGAATTTGGAATCATCTCGAGATGATTCCAAATTCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-1163s1c1
Sequence:CCGGCGGCAAGAAGAGATTAGCAAACTCGAGTTTGCTAATCTCTTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012154.2-2776s1c1
Sequence:CCGGCCAGATTTCAAACTTGGATTTCTCGAGAAATCCAAGTTTGAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012154
AGO2 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012154.3-792s21c1
Sequence:CCGGACAGATTCCCAAAGGGTAAAGCTCGAGCTTTACCCTTTGGGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012154.3-2717s21c1
Sequence:CCGGATCGAACATGAGACGTCATTGCTCGAGCAATGACGTCTCATGTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012154.3-2912s21c1
Sequence:CCGGCTATGAACTCAGGGCTTTAAACTCGAGTTTAAAGCCCTGAGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-719s1c1
Sequence:CCGGGCACAGCCAGTAATCGAGTTTCTCGAGAAACTCGATTACTGGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-150s1c1
Sequence:CCGGCAATCAAATTACAGGCCAATTCTCGAGAATTGGCCTGTAATTTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-1219s1c1
Sequence:CCGGCGTCCGTGAATTTGGAATCATCTCGAGATGATTCCAAATTCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012154.2-1163s1c1
Sequence:CCGGCGGCAAGAAGAGATTAGCAAACTCGAGTTTGCTAATCTCTTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012154.2-2776s1c1
Sequence:CCGGCCAGATTTCAAACTTGGATTTCTCGAGAAATCCAAGTTTGAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153178
VALIDATED
AGO2 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2453s21c1
Sequence:CCGGACGTGCTTTGGGATGACAATCCTCGAGGATTGTCATCCCAAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2834s21c1
Sequence:CCGGATCGAACATGAGACGTCTTTGCTCGAGCAAAGACGTCTCATGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-836s21c1
Sequence:CCGGCACAGCCAGTGATCGAGTTTGCTCGAGCAAACTCGATCACTGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2090s21c1
Sequence:CCGGTGGTACGAGAGTTGCTCATTCCTCGAGGAATGAGCAACTCTCGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-1300s21c1
Sequence:CCGGCTGATGCGAAGTGCAAGTTTCCTCGAGGAAACTTGCACTTCGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153178.2-1707s1c1
Sequence:CCGGCCTATCCAATCTCTGCTTAAACTCGAGTTTAAGCAGAGATTGGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153178.2-139s1c1
Sequence:CCGGACAATCAAACTACAGGCCAATCTCGAGATTGGCCTGTAGTTTGATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-2114s1c1
Sequence:CCGGAGAAGGACTATCAGCCAGGAACTCGAGTTCCTGGCTGATAGTCCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-790s1c1
Sequence:CCGGCAAAGGGTAAAGTTTACCAAACTCGAGTTTGGTAAACTTTACCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-394s1c1
Sequence:CCGGGAAGGCAAAGATCGCATCTTACTCGAGTAAGATGCGATCTTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153178
VALIDATED
AGO2 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2453s21c1
Sequence:CCGGACGTGCTTTGGGATGACAATCCTCGAGGATTGTCATCCCAAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2834s21c1
Sequence:CCGGATCGAACATGAGACGTCTTTGCTCGAGCAAAGACGTCTCATGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-836s21c1
Sequence:CCGGCACAGCCAGTGATCGAGTTTGCTCGAGCAAACTCGATCACTGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2090s21c1
Sequence:CCGGTGGTACGAGAGTTGCTCATTCCTCGAGGAATGAGCAACTCTCGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-1300s21c1
Sequence:CCGGCTGATGCGAAGTGCAAGTTTCCTCGAGGAAACTTGCACTTCGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153178.2-1707s1c1
Sequence:CCGGCCTATCCAATCTCTGCTTAAACTCGAGTTTAAGCAGAGATTGGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153178.2-139s1c1
Sequence:CCGGACAATCAAACTACAGGCCAATCTCGAGATTGGCCTGTAGTTTGATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-2114s1c1
Sequence:CCGGAGAAGGACTATCAGCCAGGAACTCGAGTTCCTGGCTGATAGTCCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-790s1c1
Sequence:CCGGCAAAGGGTAAAGTTTACCAAACTCGAGTTTGGTAAACTTTACCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-394s1c1
Sequence:CCGGGAAGGCAAAGATCGCATCTTACTCGAGTAAGATGCGATCTTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153178
VALIDATED
AGO2 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2453s21c1
Sequence:CCGGACGTGCTTTGGGATGACAATCCTCGAGGATTGTCATCCCAAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2834s21c1
Sequence:CCGGATCGAACATGAGACGTCTTTGCTCGAGCAAAGACGTCTCATGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-836s21c1
Sequence:CCGGCACAGCCAGTGATCGAGTTTGCTCGAGCAAACTCGATCACTGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-2090s21c1
Sequence:CCGGTGGTACGAGAGTTGCTCATTCCTCGAGGAATGAGCAACTCTCGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153178.3-1300s21c1
Sequence:CCGGCTGATGCGAAGTGCAAGTTTCCTCGAGGAAACTTGCACTTCGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153178.2-1707s1c1
Sequence:CCGGCCTATCCAATCTCTGCTTAAACTCGAGTTTAAGCAGAGATTGGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153178.2-139s1c1
Sequence:CCGGACAATCAAACTACAGGCCAATCTCGAGATTGGCCTGTAGTTTGATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-2114s1c1
Sequence:CCGGAGAAGGACTATCAGCCAGGAACTCGAGTTCCTGGCTGATAGTCCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-790s1c1
Sequence:CCGGCAAAGGGTAAAGTTTACCAAACTCGAGTTTGGTAAACTTTACCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153178.2-394s1c1
Sequence:CCGGGAAGGCAAAGATCGCATCTTACTCGAGTAAGATGCGATCTTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks