EMAIL THIS PAGE TO A FRIEND

AGO3

argonaute RISC catalytic component 3

113 Gene Product Result for
Synonyms: EIF2C3
UniProtKB ID: Q9H9G7, B1ALI0, Q5TA55, Q9H1U6
Gene ID:
Human(192669) Summary: This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(214150) argonaute RISC catalytic subunit 3
Rat(313593) argonaute RISC catalytic component 3
fruit fly(3355150) Argonaute 3
cow(406231) eukaryotic translation initiation factor 2C, 3
Thale Cress(840017) protein ARGONAUTE 3
chicken(419628) eukaryotic translation initiation factor 2C, 3
naked mole-rat(101716266) argonaute RISC catalytic component 3
domestic guinea pig(100732671) argonaute RISC catalytic component 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024852 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101691 MISSION® esiRNA esiRNA human EIF2C3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024852 Rosetta Predictions human pricing
NM_177422 Rosetta Predictions human pricing
XM_001058231 Rosetta Predictions rat pricing
XM_233543 Rosetta Predictions rat pricing
NM_153402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094528 predicted 2618
2 SASI_Hs01_00094529 predicted 1956
3 SASI_Hs01_00094530 predicted 2379
4 SASI_Hs01_00094531 predicted 1270
5 SASI_Hs01_00094532 predicted 2361
6 SASI_Hs02_00357428 predicted 1568
7 SASI_Hs01_00094534 predicted 2804
8 SASI_Hs01_00094535 predicted 1883
9 SASI_Hs01_00094536 predicted 1169
10 SASI_Hs01_00094537 predicted 1923
11 SASI_Hs01_00094533 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029098 predicted 2361
2 SASI_Hs01_00029099 predicted 1703
3 SASI_Hs01_00029100 predicted 2127
4 SASI_Hs01_00029101 predicted 1012
5 SASI_Hs01_00029102 predicted 2102
6 SASI_Hs02_00369321 predicted 1312
7 SASI_Hs01_00029104 predicted 2540
8 SASI_Hs01_00029105 predicted 1622
9 SASI_Hs01_00029106 predicted 909
10 SASI_Hs01_00029107 predicted 1669
11 SASI_Hs01_00029103 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289047 predicted 2265
2 SASI_Rn02_00289048 predicted 1272
3 SASI_Rn02_00289049 predicted 2790
4 SASI_Rn02_00289050 predicted 1304
5 SASI_Rn02_00289051 predicted 2800
6 SASI_Rn02_00289052 predicted 1159
7 SASI_Rn02_00289053 predicted 1894
8 SASI_Rn02_00289054 predicted 2862
9 SASI_Rn02_00289055 predicted 850
10 SASI_Rn02_00289056 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387864 predicted 1269
2 SASI_Rn02_00387865 predicted 1323
3 SASI_Rn02_00387866 predicted 1299
4 SASI_Rn02_00387867 predicted 1159
5 SASI_Rn02_00387868 predicted 1894
6 SASI_Rn02_00387869 predicted 927
7 SASI_Rn02_00387870 predicted 528
8 SASI_Rn02_00387871 predicted 847
9 SASI_Rn02_00387872 predicted 949
10 SASI_Rn02_00387873 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035655 predicted 2465
2 SASI_Mm01_00035656 predicted 2129
3 SASI_Mm01_00035657 predicted 1316
4 SASI_Mm01_00035658 predicted 2318
5 SASI_Mm01_00035659 predicted 2241
6 SASI_Mm02_00343186 predicted 1182
7 SASI_Mm01_00035660 predicted 2255
8 SASI_Mm01_00035661 predicted 800
9 SASI_Mm01_00035662 predicted 457
10 SASI_Mm01_00035663 predicted 1750
11 SASI_Mm01_00035664 predicted 2338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153402
AGO3 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-2081s1c1
Sequence:CCGGCCCGATTCAAACCTACTCGTACTCGAGTACGAGTAGGTTTGAATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-220s1c1
Sequence:CCGGCAAGTTGAAATCCCAAAGATTCTCGAGAATCTTTGGGATTTCAACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-989s1c1
Sequence:CCGGCCTTTCCTTTACAGCTAGAAACTCGAGTTTCTAGCTGTAAAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-2209s1c1
Sequence:CCGGCCTGGAATAACCTACATTGTTCTCGAGAACAATGTAGGTTATTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-1125s1c1
Sequence:CCGGCCTGCCACTAGAAGTCTGTAACTCGAGTTACAGACTTCTAGTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153402.2-1009s21c1
Sequence:CCGGGACTGATTCTCATCGGGTAAACTCGAGTTTACCCGATGAGAATCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153402.2-2833s21c1
Sequence:CCGGCGCTTAACAAGTCCAAGTTTACTCGAGTAAACTTGGACTTGTTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153402
AGO3 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-2081s1c1
Sequence:CCGGCCCGATTCAAACCTACTCGTACTCGAGTACGAGTAGGTTTGAATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-220s1c1
Sequence:CCGGCAAGTTGAAATCCCAAAGATTCTCGAGAATCTTTGGGATTTCAACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-989s1c1
Sequence:CCGGCCTTTCCTTTACAGCTAGAAACTCGAGTTTCTAGCTGTAAAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-2209s1c1
Sequence:CCGGCCTGGAATAACCTACATTGTTCTCGAGAACAATGTAGGTTATTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-1125s1c1
Sequence:CCGGCCTGCCACTAGAAGTCTGTAACTCGAGTTACAGACTTCTAGTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153402.2-1009s21c1
Sequence:CCGGGACTGATTCTCATCGGGTAAACTCGAGTTTACCCGATGAGAATCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153402.2-2833s21c1
Sequence:CCGGCGCTTAACAAGTCCAAGTTTACTCGAGTAAACTTGGACTTGTTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153402
AGO3 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-2081s1c1
Sequence:CCGGCCCGATTCAAACCTACTCGTACTCGAGTACGAGTAGGTTTGAATCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-220s1c1
Sequence:CCGGCAAGTTGAAATCCCAAAGATTCTCGAGAATCTTTGGGATTTCAACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-989s1c1
Sequence:CCGGCCTTTCCTTTACAGCTAGAAACTCGAGTTTCTAGCTGTAAAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-2209s1c1
Sequence:CCGGCCTGGAATAACCTACATTGTTCTCGAGAACAATGTAGGTTATTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153402.1-1125s1c1
Sequence:CCGGCCTGCCACTAGAAGTCTGTAACTCGAGTTACAGACTTCTAGTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153402.2-1009s21c1
Sequence:CCGGGACTGATTCTCATCGGGTAAACTCGAGTTTACCCGATGAGAATCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153402.2-2833s21c1
Sequence:CCGGCGCTTAACAAGTCCAAGTTTACTCGAGTAAACTTGGACTTGTTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024852
VALIDATED
AGO3 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-1463s1c1
Sequence:CCGGCGGGATGAAATGGCTCATGTACTCGAGTACATGAGCCATTTCATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024852.2-2806s1c1
Sequence:CCGGCCAAGATACCTTACGCACAATCTCGAGATTGTGCGTAAGGTATCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-2198s1c1
Sequence:CCGGCGGGAACTTCTTATTCAATTTCTCGAGAAATTGAATAAGAAGTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-3062s1c1
Sequence:CCGGGCGGTCTCCTATAGGAAGTATCTCGAGATACTTCCTATAGGAGACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024852.2-1801s1c1
Sequence:CCGGCCTACAGCTTATTATCGTCATCTCGAGATGACGATAATAAGCTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2833s21c1
Sequence:CCGGCGCTTAAATAGTCCAAGTATACTCGAGTATACTTGGACTATTTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2281s21c1
Sequence:CCGGGCAGTTTAGGCAGGTATTATACTCGAGTATAATACCTGCCTAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-569s21c1
Sequence:CCGGGTAGATTTAGACGTTACTTTACTCGAGTAAAGTAACGTCTAAATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-1173s21c1
Sequence:CCGGAGAGAACAGTAGCGCAGTATTCTCGAGAATACTGCGCTACTGTTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2387s21c1
Sequence:CCGGAGACATCACACTCGATTATTTCTCGAGAAATAATCGAGTGTGATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-898s21c1
Sequence:CCGGGATGCTTAATATCGATGTTTCCTCGAGGAAACATCGATATTAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024852
VALIDATED
AGO3 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-1463s1c1
Sequence:CCGGCGGGATGAAATGGCTCATGTACTCGAGTACATGAGCCATTTCATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024852.2-2806s1c1
Sequence:CCGGCCAAGATACCTTACGCACAATCTCGAGATTGTGCGTAAGGTATCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-2198s1c1
Sequence:CCGGCGGGAACTTCTTATTCAATTTCTCGAGAAATTGAATAAGAAGTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-3062s1c1
Sequence:CCGGGCGGTCTCCTATAGGAAGTATCTCGAGATACTTCCTATAGGAGACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024852.2-1801s1c1
Sequence:CCGGCCTACAGCTTATTATCGTCATCTCGAGATGACGATAATAAGCTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2833s21c1
Sequence:CCGGCGCTTAAATAGTCCAAGTATACTCGAGTATACTTGGACTATTTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2281s21c1
Sequence:CCGGGCAGTTTAGGCAGGTATTATACTCGAGTATAATACCTGCCTAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-569s21c1
Sequence:CCGGGTAGATTTAGACGTTACTTTACTCGAGTAAAGTAACGTCTAAATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-1173s21c1
Sequence:CCGGAGAGAACAGTAGCGCAGTATTCTCGAGAATACTGCGCTACTGTTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2387s21c1
Sequence:CCGGAGACATCACACTCGATTATTTCTCGAGAAATAATCGAGTGTGATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-898s21c1
Sequence:CCGGGATGCTTAATATCGATGTTTCCTCGAGGAAACATCGATATTAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024852
VALIDATED
AGO3 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-1463s1c1
Sequence:CCGGCGGGATGAAATGGCTCATGTACTCGAGTACATGAGCCATTTCATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024852.2-2806s1c1
Sequence:CCGGCCAAGATACCTTACGCACAATCTCGAGATTGTGCGTAAGGTATCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-2198s1c1
Sequence:CCGGCGGGAACTTCTTATTCAATTTCTCGAGAAATTGAATAAGAAGTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_024852.2-3062s1c1
Sequence:CCGGGCGGTCTCCTATAGGAAGTATCTCGAGATACTTCCTATAGGAGACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024852.2-1801s1c1
Sequence:CCGGCCTACAGCTTATTATCGTCATCTCGAGATGACGATAATAAGCTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2833s21c1
Sequence:CCGGCGCTTAAATAGTCCAAGTATACTCGAGTATACTTGGACTATTTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2281s21c1
Sequence:CCGGGCAGTTTAGGCAGGTATTATACTCGAGTATAATACCTGCCTAAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-569s21c1
Sequence:CCGGGTAGATTTAGACGTTACTTTACTCGAGTAAAGTAACGTCTAAATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-1173s21c1
Sequence:CCGGAGAGAACAGTAGCGCAGTATTCTCGAGAATACTGCGCTACTGTTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-2387s21c1
Sequence:CCGGAGACATCACACTCGATTATTTCTCGAGAAATAATCGAGTGTGATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024852.2-898s21c1
Sequence:CCGGGATGCTTAATATCGATGTTTCCTCGAGGAAACATCGATATTAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)