EMAIL THIS PAGE TO A FRIEND

AGO4

argonaute RISC catalytic component 4

229 Gene Product Result for
Synonyms: EIF2C4
UniProtKB ID: Q9HCK5, A7MD27
Gene ID:
Human(192670) Summary: This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic containing PAZ and PIWI domains, and it may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and eukaryotic translation initiation factor 2C, 1. [provided by RefSeq, Jul 2008]
Mouse(76850) argonaute RISC catalytic subunit 4
Rat(298533) argonaute RISC catalytic component 4
Zebrafish(100535764) argonaute RISC catalytic component 4
cow(528046) argonaute RISC catalytic component 4
chicken(419629) eukaryotic translation initiation factor 2C, 4
Thale Cress(817246) argonaute 4
domestic guinea pig(100729089) argonaute RISC catalytic component 4
naked mole-rat(101715103) argonaute RISC catalytic component 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017629 Rosetta Predictions human pricing
NM_001106686 Rosetta Predictions rat pricing
NM_153177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154824 predicted 1071
2 SASI_Hs02_00350306 predicted 2221
3 SASI_Hs01_00154827 predicted 1775
4 SASI_Hs01_00154828 predicted 2631
5 SASI_Hs01_00154829 predicted 2595
6 SASI_Hs01_00154830 predicted 1311
7 SASI_Hs01_00154831 predicted 1283
8 SASI_Hs01_00154832 predicted 2276
9 SASI_Hs01_00154833 predicted 1416
10 SASI_Hs02_00350307 predicted 1296
11 SASI_Hs01_00154825 predicted 461
12 SASI_Hs01_00154826 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221388 predicted 1197
2 SASI_Rn02_00221389 predicted 2246
3 SASI_Rn02_00221390 predicted 1349
4 SASI_Rn02_00221391 predicted 2072
5 SASI_Rn02_00221392 predicted 1711
6 SASI_Rn02_00221393 predicted 1799
7 SASI_Rn02_00221394 predicted 1701
8 SASI_Rn02_00221395 predicted 2341
9 SASI_Rn02_00221396 predicted 995
10 SASI_Rn02_00221397 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145636 predicted 1204
2 SASI_Mm01_00145637 predicted 2081
3 SASI_Mm01_00145638 predicted 1185
4 SASI_Mm01_00145639 predicted 1263
5 SASI_Mm01_00145640 predicted 2126
6 SASI_Mm01_00145641 predicted 1614
7 SASI_Mm01_00145642 predicted 1075
8 SASI_Mm01_00145643 predicted 1078
9 SASI_Mm01_00145644 predicted 680
10 SASI_Mm01_00145645 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153177
AGO4 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153177.3-3155s21c1
Sequence:CCGGATTCACCGCATCTAGTCTTATCTCGAGATAAGACTAGATGCGGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153177.3-339s21c1
Sequence:CCGGTCGACTGTTAGCCAATCATTTCTCGAGAAATGATTGGCTAACAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153177.3-2044s21c1
Sequence:CCGGGACGGGAAGAAGCCTTCTATTCTCGAGAATAGAAGGCTTCTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-294s1c1
Sequence:CCGGCGGACGGGATAGGATTGATATCTCGAGATATCAATCCTATCCCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-1483s1c1
Sequence:CCGGCCCATGTTTAAACATCTGAAACTCGAGTTTCAGATGTTTAAACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-2443s1c1
Sequence:CCGGGCAAGGTATCATTTGGTGGATCTCGAGATCCACCAAATGATACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-210s1c1
Sequence:CCGGGCACTTCAAGATGCAGATATTCTCGAGAATATCTGCATCTTGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-2051s1c1
Sequence:CCGGCGGAGCTAATAGCAATTCGAACTCGAGTTCGAATTGCTATTAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153177
AGO4 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153177.3-3155s21c1
Sequence:CCGGATTCACCGCATCTAGTCTTATCTCGAGATAAGACTAGATGCGGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153177.3-339s21c1
Sequence:CCGGTCGACTGTTAGCCAATCATTTCTCGAGAAATGATTGGCTAACAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153177.3-2044s21c1
Sequence:CCGGGACGGGAAGAAGCCTTCTATTCTCGAGAATAGAAGGCTTCTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-294s1c1
Sequence:CCGGCGGACGGGATAGGATTGATATCTCGAGATATCAATCCTATCCCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-1483s1c1
Sequence:CCGGCCCATGTTTAAACATCTGAAACTCGAGTTTCAGATGTTTAAACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-2443s1c1
Sequence:CCGGGCAAGGTATCATTTGGTGGATCTCGAGATCCACCAAATGATACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-210s1c1
Sequence:CCGGGCACTTCAAGATGCAGATATTCTCGAGAATATCTGCATCTTGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-2051s1c1
Sequence:CCGGCGGAGCTAATAGCAATTCGAACTCGAGTTCGAATTGCTATTAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153177
AGO4 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153177.3-3155s21c1
Sequence:CCGGATTCACCGCATCTAGTCTTATCTCGAGATAAGACTAGATGCGGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153177.3-339s21c1
Sequence:CCGGTCGACTGTTAGCCAATCATTTCTCGAGAAATGATTGGCTAACAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153177.3-2044s21c1
Sequence:CCGGGACGGGAAGAAGCCTTCTATTCTCGAGAATAGAAGGCTTCTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-294s1c1
Sequence:CCGGCGGACGGGATAGGATTGATATCTCGAGATATCAATCCTATCCCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-1483s1c1
Sequence:CCGGCCCATGTTTAAACATCTGAAACTCGAGTTTCAGATGTTTAAACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-2443s1c1
Sequence:CCGGGCAAGGTATCATTTGGTGGATCTCGAGATCCACCAAATGATACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-210s1c1
Sequence:CCGGGCACTTCAAGATGCAGATATTCTCGAGAATATCTGCATCTTGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153177.1-2051s1c1
Sequence:CCGGCGGAGCTAATAGCAATTCGAACTCGAGTTCGAATTGCTATTAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017629
VALIDATED
AGO4 MISSION shRNA Bacterial Glycerol Stock
argonaute RISC catalytic component 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017629.2-1421s21c1
Sequence:CCGGCAATATGGAGGCCGGAATAAACTCGAGTTTATTCCGGCCTCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017629.2-3388s21c1
Sequence:CCGGACAGGCAATTTGCACTATATTCTCGAGAATATAGTGCAAATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017629.2-274s21c1
Sequence:CCGGTCGACTGTTAGCCAATCATTTCTCGAGAAATGATTGGCTAACAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017629.2-2748s21c1
Sequence:CCGGATACCCAGCACACGATGTATTCTCGAGAATACATCGTGTGCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017629.2-325s21c1
Sequence:CCGGTCACTATGATGTGGATATTAACTCGAGTTAATATCCACATCATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017629.2-3272s1c1
Sequence:CCGGGCCACTGTAAATGCCTTTAATCTCGAGATTAAAGGCATTTACAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-398s1c1
Sequence:CCGGCGGCACTTCAAGATGCAAATACTCGAGTATTTGCATCTTGAAGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017629.2-1538s1c1
Sequence:CCGGCCTCAGAAACAATGTAGGGAACTCGAGTTCCCTACATTGTTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-1707s1c1
Sequence:CCGGGCCTACAGCTAATAGTGGTTACTCGAGTAACCACTATTAGCTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-1406s1c1
Sequence:CCGGCCAGCACCAATGCTGCAATATCTCGAGATATTGCAGCATTGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017629
VALIDATED
AGO4 MISSION shRNA shRNA Plasmid DNA
argonaute RISC catalytic component 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017629.2-1421s21c1
Sequence:CCGGCAATATGGAGGCCGGAATAAACTCGAGTTTATTCCGGCCTCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017629.2-3388s21c1
Sequence:CCGGACAGGCAATTTGCACTATATTCTCGAGAATATAGTGCAAATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017629.2-274s21c1
Sequence:CCGGTCGACTGTTAGCCAATCATTTCTCGAGAAATGATTGGCTAACAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017629.2-2748s21c1
Sequence:CCGGATACCCAGCACACGATGTATTCTCGAGAATACATCGTGTGCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017629.2-325s21c1
Sequence:CCGGTCACTATGATGTGGATATTAACTCGAGTTAATATCCACATCATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017629.2-3272s1c1
Sequence:CCGGGCCACTGTAAATGCCTTTAATCTCGAGATTAAAGGCATTTACAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-398s1c1
Sequence:CCGGCGGCACTTCAAGATGCAAATACTCGAGTATTTGCATCTTGAAGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017629.2-1538s1c1
Sequence:CCGGCCTCAGAAACAATGTAGGGAACTCGAGTTCCCTACATTGTTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-1707s1c1
Sequence:CCGGGCCTACAGCTAATAGTGGTTACTCGAGTAACCACTATTAGCTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-1406s1c1
Sequence:CCGGCCAGCACCAATGCTGCAATATCTCGAGATATTGCAGCATTGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017629
VALIDATED
AGO4 MISSION shRNA Lentiviral Transduction Particles
argonaute RISC catalytic component 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017629.2-1421s21c1
Sequence:CCGGCAATATGGAGGCCGGAATAAACTCGAGTTTATTCCGGCCTCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017629.2-3388s21c1
Sequence:CCGGACAGGCAATTTGCACTATATTCTCGAGAATATAGTGCAAATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017629.2-274s21c1
Sequence:CCGGTCGACTGTTAGCCAATCATTTCTCGAGAAATGATTGGCTAACAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017629.2-2748s21c1
Sequence:CCGGATACCCAGCACACGATGTATTCTCGAGAATACATCGTGTGCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017629.2-325s21c1
Sequence:CCGGTCACTATGATGTGGATATTAACTCGAGTTAATATCCACATCATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017629.2-3272s1c1
Sequence:CCGGGCCACTGTAAATGCCTTTAATCTCGAGATTAAAGGCATTTACAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-398s1c1
Sequence:CCGGCGGCACTTCAAGATGCAAATACTCGAGTATTTGCATCTTGAAGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017629.2-1538s1c1
Sequence:CCGGCCTCAGAAACAATGTAGGGAACTCGAGTTCCCTACATTGTTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-1707s1c1
Sequence:CCGGGCCTACAGCTAATAGTGGTTACTCGAGTAACCACTATTAGCTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017629.2-1406s1c1
Sequence:CCGGCCAGCACCAATGCTGCAATATCTCGAGATATTGCAGCATTGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks