EMAIL THIS PAGE TO A FRIEND

AGPAT1

1-acylglycerol-3-phosphate O-acyltransferase 1

143 Gene Product Result for
Synonyms: 1-AGPAT1 G15 LPAAT-alpha LPAATA
UniProtKB ID: Q99943, A2BFI5, Q5BL03
Gene ID:
Human(10554) Summary: This gene encodes an enzyme that converts lysophosphatidic acid (LPA) into phosphatidic acid (PA). LPA and PA are two phospholipids involved in signal transduction and in lipid biosynthesis in cells. This enzyme localizes to the endoplasmic reticulum. This gene is located in the class III region of the human major histocompatibility complex. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(55979) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
Rat(406165) 1-acylglycerol-3-phosphate O-acyltransferase 1
chicken(419941) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
dog(474857) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
domestic cat(101096064) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
cow(282137) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
naked mole-rat(101712016) 1-acylglycerol-3-phosphate O-acyltransferase 1
domestic guinea pig(100713674) 1-acylglycerol-3-phosphate O-acyltransferase 1
sheep(101112605) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
sheep(443121) 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006411 Rosetta Predictions human pricing
NM_032741 Rosetta Predictions human pricing
NM_212458 Rosetta Predictions rat pricing
NM_018862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341508 predicted 1547
2 SASI_Hs01_00221672 predicted 1636
3 SASI_Hs01_00221673 predicted 1585
4 SASI_Hs01_00221676 predicted 1075
5 SASI_Hs01_00221680 predicted 1604
6 SASI_Hs01_00221681 predicted 1024
7 SASI_Hs02_00341509 predicted 1538
8 SASI_Hs02_00341510 predicted 1487
9 SASI_Hs02_00341511 predicted 974
10 SASI_Hs01_00221674 predicted 1397
11 SASI_Hs01_00221675 predicted 784
12 SASI_Hs01_00221677 predicted 642
13 SASI_Hs01_00221678 predicted 1412
14 SASI_Hs01_00221679 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360290 predicted 1300
2 SASI_Hs01_00032014 predicted 1391
3 SASI_Hs01_00032015 predicted 1339
4 SASI_Hs01_00032018 predicted 835
5 SASI_Hs01_00032022 predicted 1359
6 SASI_Hs01_00032023 predicted 783
7 SASI_Hs02_00360291 predicted 1298
8 SASI_Hs02_00360292 predicted 1244
9 SASI_Hs02_00360293 predicted 733
10 SASI_Hs01_00032016 predicted 1155
11 SASI_Hs01_00032017 predicted 534
12 SASI_Hs01_00032019 predicted 395
13 SASI_Hs01_00032020 predicted 1163
14 SASI_Hs01_00032021 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104888 predicted 1435
2 SASI_Rn01_00104889 predicted 702
3 SASI_Rn02_00270461 predicted 378
4 SASI_Rn01_00104890 predicted 1390
5 SASI_Rn01_00104892 predicted 335
6 SASI_Rn01_00104894 predicted 1446
7 SASI_Rn01_00104895 predicted 1343
8 SASI_Rn01_00104896 predicted 1227
9 SASI_Rn01_00104897 predicted 559
10 SASI_Rn02_00270462 predicted 343
11 SASI_Rn01_00104891 predicted 1226
12 SASI_Rn01_00104893 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324228 predicted 1164
2 SASI_Mm01_00179381 predicted 352
3 SASI_Mm01_00179383 predicted 685
4 SASI_Mm01_00179384 predicted 440
5 SASI_Mm01_00179385 predicted 1398
6 SASI_Mm01_00179386 predicted 675
7 SASI_Mm01_00179387 predicted 1240
8 SASI_Mm01_00179388 predicted 1397
9 SASI_Mm01_00179389 predicted 435
10 SASI_Mm01_00179390 predicted 547
11 SASI_Mm01_00179382 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006411
VALIDATED
AGPAT1 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-606s1c1
Sequence:CCGGGCCCTATGTTGTTGTCTCCAACTCGAGTTGGAGACAACAACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-957s1c1
Sequence:CCGGCCAAGACTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-1081s1c1
Sequence:CCGGCGGCACTCCATGCTCACTGTTCTCGAGAACAGTGAGCATGGAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-504s1c1
Sequence:CCGGCGTCGAGAACATGAAGATCTTCTCGAGAAGATCTTCATGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-537s1c1
Sequence:CCGGGCTCCACATCAAATACCTGTACTCGAGTACAGGTATTTGATGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006411.2-606s21c1
Sequence:CCGGGCCCTATGTTGTTGTCTCCAACTCGAGTTGGAGACAACAACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-957s21c1
Sequence:CCGGCCAAGACTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-537s21c1
Sequence:CCGGGCTCCACATCAAATACCTGTACTCGAGTACAGGTATTTGATGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-504s21c1
Sequence:CCGGCGTCGAGAACATGAAGATCTTCTCGAGAAGATCTTCATGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006411
VALIDATED
AGPAT1 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-606s1c1
Sequence:CCGGGCCCTATGTTGTTGTCTCCAACTCGAGTTGGAGACAACAACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-957s1c1
Sequence:CCGGCCAAGACTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-1081s1c1
Sequence:CCGGCGGCACTCCATGCTCACTGTTCTCGAGAACAGTGAGCATGGAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-504s1c1
Sequence:CCGGCGTCGAGAACATGAAGATCTTCTCGAGAAGATCTTCATGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-537s1c1
Sequence:CCGGGCTCCACATCAAATACCTGTACTCGAGTACAGGTATTTGATGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006411.2-606s21c1
Sequence:CCGGGCCCTATGTTGTTGTCTCCAACTCGAGTTGGAGACAACAACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-957s21c1
Sequence:CCGGCCAAGACTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-537s21c1
Sequence:CCGGGCTCCACATCAAATACCTGTACTCGAGTACAGGTATTTGATGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-504s21c1
Sequence:CCGGCGTCGAGAACATGAAGATCTTCTCGAGAAGATCTTCATGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006411
VALIDATED
AGPAT1 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-606s1c1
Sequence:CCGGGCCCTATGTTGTTGTCTCCAACTCGAGTTGGAGACAACAACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-957s1c1
Sequence:CCGGCCAAGACTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-1081s1c1
Sequence:CCGGCGGCACTCCATGCTCACTGTTCTCGAGAACAGTGAGCATGGAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-504s1c1
Sequence:CCGGCGTCGAGAACATGAAGATCTTCTCGAGAAGATCTTCATGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006411.2-537s1c1
Sequence:CCGGGCTCCACATCAAATACCTGTACTCGAGTACAGGTATTTGATGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006411.2-606s21c1
Sequence:CCGGGCCCTATGTTGTTGTCTCCAACTCGAGTTGGAGACAACAACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-957s21c1
Sequence:CCGGCCAAGACTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-537s21c1
Sequence:CCGGGCTCCACATCAAATACCTGTACTCGAGTACAGGTATTTGATGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006411.2-504s21c1
Sequence:CCGGCGTCGAGAACATGAAGATCTTCTCGAGAAGATCTTCATGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018862
VALIDATED
AGPAT1 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018862.2-246s1c1
Sequence:CCGGCAATGTCGAGAACATGAAGATCTCGAGATCTTCATGTTCTCGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-243s1c1
Sequence:CCGGGCGCAATGTCGAGAACATGAACTCGAGTTCATGTTCTCGACATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-147s1c1
Sequence:CCGGCAGCTCCAGTGCCAAGTATTTCTCGAGAAATACTTGGCACTGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-168s1c1
Sequence:CCGGCTTTAAGATGGCCTTCTACAACTCGAGTTGTAGAAGGCCATCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-152s1c1
Sequence:CCGGCCAGTGCCAAGTATTTCTTTACTCGAGTAAAGAAATACTTGGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-153s1c1
Sequence:CCGGCAGTGCCAAGTATTTCTTTAACTCGAGTTAAAGAAATACTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-168s21c1
Sequence:CCGGCTTTAAGATGGCCTTCTACAACTCGAGTTGTAGAAGGCCATCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-1278s21c1
Sequence:CCGGCGTTCTGAGGAGCAATCTATCCTCGAGGATAGATTGCTCCTCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018862.2-1497s1c1
Sequence:CCGGGCATACTCCAGATGCCAATTTCTCGAGAAATTGGCATCTGGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-152s21c1
Sequence:CCGGCCAGTGCCAAGTATTTCTTTACTCGAGTAAAGAAATACTTGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-435s21c1
Sequence:CCGGTGCCAAGCGTGAGCTACTATGCTCGAGCATAGTAGCTCACGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-243s21c1
Sequence:CCGGGCGCAATGTCGAGAACATGAACTCGAGTTCATGTTCTCGACATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018862
VALIDATED
AGPAT1 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018862.2-246s1c1
Sequence:CCGGCAATGTCGAGAACATGAAGATCTCGAGATCTTCATGTTCTCGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-243s1c1
Sequence:CCGGGCGCAATGTCGAGAACATGAACTCGAGTTCATGTTCTCGACATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-147s1c1
Sequence:CCGGCAGCTCCAGTGCCAAGTATTTCTCGAGAAATACTTGGCACTGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-168s1c1
Sequence:CCGGCTTTAAGATGGCCTTCTACAACTCGAGTTGTAGAAGGCCATCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-152s1c1
Sequence:CCGGCCAGTGCCAAGTATTTCTTTACTCGAGTAAAGAAATACTTGGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-153s1c1
Sequence:CCGGCAGTGCCAAGTATTTCTTTAACTCGAGTTAAAGAAATACTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-168s21c1
Sequence:CCGGCTTTAAGATGGCCTTCTACAACTCGAGTTGTAGAAGGCCATCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-1278s21c1
Sequence:CCGGCGTTCTGAGGAGCAATCTATCCTCGAGGATAGATTGCTCCTCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018862.2-1497s1c1
Sequence:CCGGGCATACTCCAGATGCCAATTTCTCGAGAAATTGGCATCTGGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-152s21c1
Sequence:CCGGCCAGTGCCAAGTATTTCTTTACTCGAGTAAAGAAATACTTGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-435s21c1
Sequence:CCGGTGCCAAGCGTGAGCTACTATGCTCGAGCATAGTAGCTCACGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-243s21c1
Sequence:CCGGGCGCAATGTCGAGAACATGAACTCGAGTTCATGTTCTCGACATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018862
VALIDATED
AGPAT1 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018862.2-246s1c1
Sequence:CCGGCAATGTCGAGAACATGAAGATCTCGAGATCTTCATGTTCTCGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-243s1c1
Sequence:CCGGGCGCAATGTCGAGAACATGAACTCGAGTTCATGTTCTCGACATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-147s1c1
Sequence:CCGGCAGCTCCAGTGCCAAGTATTTCTCGAGAAATACTTGGCACTGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-168s1c1
Sequence:CCGGCTTTAAGATGGCCTTCTACAACTCGAGTTGTAGAAGGCCATCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-152s1c1
Sequence:CCGGCCAGTGCCAAGTATTTCTTTACTCGAGTAAAGAAATACTTGGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018862.2-153s1c1
Sequence:CCGGCAGTGCCAAGTATTTCTTTAACTCGAGTTAAAGAAATACTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-168s21c1
Sequence:CCGGCTTTAAGATGGCCTTCTACAACTCGAGTTGTAGAAGGCCATCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-1278s21c1
Sequence:CCGGCGTTCTGAGGAGCAATCTATCCTCGAGGATAGATTGCTCCTCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018862.2-1497s1c1
Sequence:CCGGGCATACTCCAGATGCCAATTTCTCGAGAAATTGGCATCTGGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-152s21c1
Sequence:CCGGCCAGTGCCAAGTATTTCTTTACTCGAGTAAAGAAATACTTGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-435s21c1
Sequence:CCGGTGCCAAGCGTGAGCTACTATGCTCGAGCATAGTAGCTCACGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018862.2-243s21c1
Sequence:CCGGGCGCAATGTCGAGAACATGAACTCGAGTTCATGTTCTCGACATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks