EMAIL THIS PAGE TO A FRIEND

AGPAT2

1-acylglycerol-3-phosphate O-acyltransferase 2

60 Gene Product Result for
Synonyms: 1-AGPAT2 BSCL BSCL1 LPAAB LPAAT-beta
Gene ID:
Human(10555) Summary: This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(67512) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
Rat(311821) 1-acylglycerol-3-phosphate O-acyltransferase 2
sheep(101114511) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
domestic guinea pig(100725130) 1-acylglycerol-3-phosphate O-acyltransferase 2
naked mole-rat(101706478) 1-acylglycerol-3-phosphate O-acyltransferase 2
Zebrafish(777624) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
chicken(772114) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
dog(491249) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
cow(512112) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
domestic cat(101094635) 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012727 Rosetta Predictions human pricing
NM_006412 Rosetta Predictions human pricing
NM_001107821 Rosetta Predictions rat pricing
NM_026212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142960 predicted 369
2 SASI_Hs01_00142961 predicted 1129
3 SASI_Hs02_00306227 predicted 1078
4 SASI_Hs01_00142962 predicted 365
5 SASI_Hs01_00142965 predicted 952
6 SASI_Hs01_00142967 predicted 1191
7 SASI_Hs01_00142968 predicted 836
8 SASI_Hs02_00306228 predicted 363
9 SASI_Hs02_00306229 predicted 367
10 SASI_Hs01_00142969 predicted 918
11 SASI_Hs01_00142963 predicted 1079
12 SASI_Hs01_00142964 predicted 364
13 SASI_Hs01_00142966 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061830 predicted 364
2 SASI_Hs01_00061831 predicted 1218
3 SASI_Hs02_00341512 predicted 1178
4 SASI_Hs01_00061832 predicted 366
5 SASI_Hs01_00061835 predicted 1049
6 SASI_Hs01_00061837 predicted 1287
7 SASI_Hs01_00061838 predicted 937
8 SASI_Hs02_00341513 predicted 366
9 SASI_Hs02_00341514 predicted 372
10 SASI_Hs01_00061839 predicted 1007
11 SASI_Hs01_00061833 predicted 1177
12 SASI_Hs01_00061834 predicted 360
13 SASI_Hs01_00061836 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232605 predicted 362
2 SASI_Rn02_00232606 predicted 349
3 SASI_Rn02_00232607 predicted 240
4 SASI_Rn02_00232608 predicted 225
5 SASI_Rn02_00232609 predicted 1074
6 SASI_Rn02_00232610 predicted 772
7 SASI_Rn02_00232611 predicted 607
8 SASI_Rn02_00232612 predicted 685
9 SASI_Rn02_00232613 predicted 1018
10 SASI_Rn02_00232614 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175545 predicted 268
2 SASI_Mm01_00175546 predicted 225
3 SASI_Mm01_00175547 predicted 206
4 SASI_Mm01_00175548 predicted 513
5 SASI_Mm01_00175549 predicted 599
6 SASI_Mm01_00175550 predicted 438
7 SASI_Mm01_00175551 predicted 324
8 SASI_Mm01_00175552 predicted 329
9 SASI_Mm01_00175553 predicted 220
10 SASI_Mm01_00175554 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006412
VALIDATED
AGPAT2 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-378s21c1
Sequence:CCGGTGTCATCGTCTCCAACCACCACTCGAGTGGTGGTTGGAGACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-1010s21c1
Sequence:CCGGACTCCTCCCGGCTTCCAAATACTCGAGTATTTGGAAGCCGGGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-593s21c1
Sequence:CCGGACCTCAAAGTGTGGATCTATCCTCGAGGATAGATCCACACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-268s21c1
Sequence:CCGGACGGTGGAGAACATGAGCATCCTCGAGGATGCTCATGTTCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-580s21c1
Sequence:CCGGATGGTCAGGGAGAACCTCAAACTCGAGTTTGAGGTTCTCCCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006412.3-604s21c1
Sequence:CCGGTGGATCTATCCCGAGGGTACTCTCGAGAGTACCCTCGGGATAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-753s21c1
Sequence:CCGGCTTCACTTCAGGAACAGTCACCTCGAGGTGACTGTTCCTGAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-1184s21c1
Sequence:CCGGTCTGGGAGCTGGGATGATAAACTCGAGTTTATCATCCCAGCTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-280s21c1
Sequence:CCGGATGAGCATCATCGGCTGGTTCCTCGAGGAACCAGCCGATGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-715s21c1
Sequence:CCGGTCTTCCTTCTCCTCCTTCTACCTCGAGGTAGAAGGAGGAGAAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-704s1c1
Sequence:CCGGCCAAGAAGAAGTTCTTCACTTCTCGAGAAGTGAAGAACTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-264s1c1
Sequence:CCGGCGTGCGAAGCTTCAAGTACTTCTCGAGAAGTACTTGAAGCTTCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006412.2-579s1c1
Sequence:CCGGCGAGGGTACTCGCAACGACAACTCGAGTTGTCGTTGCGAGTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-822s1c1
Sequence:CCGGGAGGACCACCTTCCTCCACATCTCGAGATGTGGAGGAAGGTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-690s1c1
Sequence:CCGGCTCCTTCTACAACACCAAGAACTCGAGTTCTTGGTGTTGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006412
VALIDATED
AGPAT2 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-378s21c1
Sequence:CCGGTGTCATCGTCTCCAACCACCACTCGAGTGGTGGTTGGAGACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-1010s21c1
Sequence:CCGGACTCCTCCCGGCTTCCAAATACTCGAGTATTTGGAAGCCGGGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-593s21c1
Sequence:CCGGACCTCAAAGTGTGGATCTATCCTCGAGGATAGATCCACACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-268s21c1
Sequence:CCGGACGGTGGAGAACATGAGCATCCTCGAGGATGCTCATGTTCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-580s21c1
Sequence:CCGGATGGTCAGGGAGAACCTCAAACTCGAGTTTGAGGTTCTCCCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006412.3-604s21c1
Sequence:CCGGTGGATCTATCCCGAGGGTACTCTCGAGAGTACCCTCGGGATAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-753s21c1
Sequence:CCGGCTTCACTTCAGGAACAGTCACCTCGAGGTGACTGTTCCTGAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-1184s21c1
Sequence:CCGGTCTGGGAGCTGGGATGATAAACTCGAGTTTATCATCCCAGCTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-280s21c1
Sequence:CCGGATGAGCATCATCGGCTGGTTCCTCGAGGAACCAGCCGATGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-715s21c1
Sequence:CCGGTCTTCCTTCTCCTCCTTCTACCTCGAGGTAGAAGGAGGAGAAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-704s1c1
Sequence:CCGGCCAAGAAGAAGTTCTTCACTTCTCGAGAAGTGAAGAACTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-264s1c1
Sequence:CCGGCGTGCGAAGCTTCAAGTACTTCTCGAGAAGTACTTGAAGCTTCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006412.2-579s1c1
Sequence:CCGGCGAGGGTACTCGCAACGACAACTCGAGTTGTCGTTGCGAGTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-822s1c1
Sequence:CCGGGAGGACCACCTTCCTCCACATCTCGAGATGTGGAGGAAGGTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-690s1c1
Sequence:CCGGCTCCTTCTACAACACCAAGAACTCGAGTTCTTGGTGTTGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006412
VALIDATED
AGPAT2 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-378s21c1
Sequence:CCGGTGTCATCGTCTCCAACCACCACTCGAGTGGTGGTTGGAGACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-1010s21c1
Sequence:CCGGACTCCTCCCGGCTTCCAAATACTCGAGTATTTGGAAGCCGGGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-593s21c1
Sequence:CCGGACCTCAAAGTGTGGATCTATCCTCGAGGATAGATCCACACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-268s21c1
Sequence:CCGGACGGTGGAGAACATGAGCATCCTCGAGGATGCTCATGTTCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-580s21c1
Sequence:CCGGATGGTCAGGGAGAACCTCAAACTCGAGTTTGAGGTTCTCCCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006412.3-604s21c1
Sequence:CCGGTGGATCTATCCCGAGGGTACTCTCGAGAGTACCCTCGGGATAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-753s21c1
Sequence:CCGGCTTCACTTCAGGAACAGTCACCTCGAGGTGACTGTTCCTGAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006412.3-1184s21c1
Sequence:CCGGTCTGGGAGCTGGGATGATAAACTCGAGTTTATCATCCCAGCTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-280s21c1
Sequence:CCGGATGAGCATCATCGGCTGGTTCCTCGAGGAACCAGCCGATGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006412.3-715s21c1
Sequence:CCGGTCTTCCTTCTCCTCCTTCTACCTCGAGGTAGAAGGAGGAGAAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-704s1c1
Sequence:CCGGCCAAGAAGAAGTTCTTCACTTCTCGAGAAGTGAAGAACTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-264s1c1
Sequence:CCGGCGTGCGAAGCTTCAAGTACTTCTCGAGAAGTACTTGAAGCTTCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006412.2-579s1c1
Sequence:CCGGCGAGGGTACTCGCAACGACAACTCGAGTTGTCGTTGCGAGTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-822s1c1
Sequence:CCGGGAGGACCACCTTCCTCCACATCTCGAGATGTGGAGGAAGGTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006412.2-690s1c1
Sequence:CCGGCTCCTTCTACAACACCAAGAACTCGAGTTCTTGGTGTTGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026212
VALIDATED
AGPAT2 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026212.1-168s1c1
Sequence:CCGGCGTGGATAACATGAGCATCATCTCGAGATGATGCTCATGTTATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-515s21c1
Sequence:CCGGAGGGTACACGCAACGACAATGCTCGAGCATTGTCGTTGCGTGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-310s21c1
Sequence:CCGGATGATGGGTCTCATGGAAATACTCGAGTATTTCCATGAGACCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-203s21c1
Sequence:CCGGGGTCCTTCAAGTACGTGTATGCTCGAGCATACACGTACTTGAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-272s21c1
Sequence:CCGGCCTGTGTCATCATCTCTAATCCTCGAGGATTAGAGATGATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-352s21c1
Sequence:CCGGATCGCCAAGCGTGAGCTAATGCTCGAGCATTAGCTCACGCTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026212.1-627s1c1
Sequence:CCGGCTTCTACAATGTCAAGACGAACTCGAGTTCGTCTTGACATTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026212
VALIDATED
AGPAT2 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026212.1-168s1c1
Sequence:CCGGCGTGGATAACATGAGCATCATCTCGAGATGATGCTCATGTTATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-515s21c1
Sequence:CCGGAGGGTACACGCAACGACAATGCTCGAGCATTGTCGTTGCGTGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-310s21c1
Sequence:CCGGATGATGGGTCTCATGGAAATACTCGAGTATTTCCATGAGACCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-203s21c1
Sequence:CCGGGGTCCTTCAAGTACGTGTATGCTCGAGCATACACGTACTTGAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-272s21c1
Sequence:CCGGCCTGTGTCATCATCTCTAATCCTCGAGGATTAGAGATGATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-352s21c1
Sequence:CCGGATCGCCAAGCGTGAGCTAATGCTCGAGCATTAGCTCACGCTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026212.1-627s1c1
Sequence:CCGGCTTCTACAATGTCAAGACGAACTCGAGTTCGTCTTGACATTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026212
VALIDATED
AGPAT2 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026212.1-168s1c1
Sequence:CCGGCGTGGATAACATGAGCATCATCTCGAGATGATGCTCATGTTATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-515s21c1
Sequence:CCGGAGGGTACACGCAACGACAATGCTCGAGCATTGTCGTTGCGTGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-310s21c1
Sequence:CCGGATGATGGGTCTCATGGAAATACTCGAGTATTTCCATGAGACCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-203s21c1
Sequence:CCGGGGTCCTTCAAGTACGTGTATGCTCGAGCATACACGTACTTGAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-272s21c1
Sequence:CCGGCCTGTGTCATCATCTCTAATCCTCGAGGATTAGAGATGATGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026212.1-352s21c1
Sequence:CCGGATCGCCAAGCGTGAGCTAATGCTCGAGCATTAGCTCACGCTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026212.1-627s1c1
Sequence:CCGGCTTCTACAATGTCAAGACGAACTCGAGTTCGTCTTGACATTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks