EMAIL THIS PAGE TO A FRIEND

AGPAT3

1-acylglycerol-3-phosphate O-acyltransferase 3

127 Gene Product Result for
Synonyms: LPAAT-GAMMA1 LPAAT3
Gene ID:
Human(56894) Summary: The protein encoded by this gene is an acyltransferase that converts lysophosphatidic acid into phosphatidic acid, which is the second step in the de novo phospholipid biosynthetic pathway. The encoded protein may be an integral membrane protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(28169) 1-acylglycerol-3-phosphate O-acyltransferase 3
Rat(294324) 1-acylglycerol-3-phosphate O-acyltransferase 3
Zebrafish(406734) 1-acylglycerol-3-phosphate O-acyltransferase 3
chicken(418550) 1-acylglycerol-3-phosphate O-acyltransferase 3
cow(506607) 1-acylglycerol-3-phosphate O-acyltransferase 3
Horse(100057170) 1-acylglycerol-3-phosphate O-acyltransferase 3
domestic cat(101083195) 1-acylglycerol-3-phosphate O-acyltransferase 3
dog(100687022) 1-acylglycerol-3-phosphate O-acyltransferase 3
naked mole-rat(101697430) 1-acylglycerol-3-phosphate O-acyltransferase 3
domestic guinea pig(100719295) 1-acylglycerol-3-phosphate O-acyltransferase 3
sheep(101107246) 1-acylglycerol-3-phosphate O-acyltransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037553 Rosetta Predictions human pricing
NM_020132 Rosetta Predictions human pricing
NM_001106378 Rosetta Predictions rat pricing
NM_053014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045044 predicted 1269
2 SASI_Hs01_00045046 predicted 1522
3 SASI_Hs01_00045047 predicted 1157
4 SASI_Hs02_00308320 predicted 1162
5 SASI_Hs01_00045048 predicted 502
6 SASI_Hs01_00045049 predicted 491
7 SASI_Hs01_00045050 predicted 1170
8 SASI_Hs02_00308321 predicted 1158
9 SASI_Hs01_00045053 predicted 269
10 SASI_Hs02_00308322 predicted 638
11 SASI_Hs01_00045045 predicted 901
12 SASI_Hs01_00045051 predicted 1340
13 SASI_Hs01_00045052 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171543 predicted 1389
2 SASI_Hs01_00171545 predicted 1633
3 SASI_Hs01_00171546 predicted 1284
4 SASI_Hs02_00353007 predicted 1278
5 SASI_Hs01_00171547 predicted 619
6 SASI_Hs01_00171548 predicted 606
7 SASI_Hs01_00171549 predicted 1289
8 SASI_Hs02_00353008 predicted 1279
9 SASI_Hs01_00171552 predicted 391
10 SASI_Hs02_00353009 predicted 758
11 SASI_Hs01_00171544 predicted 1024
12 SASI_Hs01_00171550 predicted 1460
13 SASI_Hs01_00171551 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218378 predicted 624
2 SASI_Rn02_00218379 predicted 1513
3 SASI_Rn02_00218380 predicted 1518
4 SASI_Rn02_00218381 predicted 1137
5 SASI_Rn02_00218382 predicted 875
6 SASI_Rn02_00218383 predicted 796
7 SASI_Rn02_00218384 predicted 1447
8 SASI_Rn02_00218385 predicted 638
9 SASI_Rn02_00218386 predicted 878
10 SASI_Rn02_00218387 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105525 predicted 1385
2 SASI_Mm01_00105526 predicted 841
3 SASI_Mm01_00105527 predicted 1420
4 SASI_Mm01_00105528 predicted 1246
5 SASI_Mm01_00105529 predicted 848
6 SASI_Mm01_00105530 predicted 1341
7 SASI_Mm01_00105531 predicted 1319
8 SASI_Mm01_00105532 predicted 589
9 SASI_Mm01_00105533 predicted 812
10 SASI_Mm01_00105534 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020132
AGPAT3 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-642s1c1
Sequence:CCGGGATTGTGTTCTGCAAGCGGAACTCGAGTTCCGCTTGCAGAACACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-1069s1c1
Sequence:CCGGGCGCTCCAGGAGATATATAATCTCGAGATTATATATCTCCTGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-909s1c1
Sequence:CCGGCCTGAACTTCAGAGGAAACAACTCGAGTTGTTTCCTCTGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-501s1c1
Sequence:CCGGCCTCAACCACAACTTCGAGATCTCGAGATCTCGAAGTTGTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-1319s1c1
Sequence:CCGGGCTACGGAAACCAAGAGTTTACTCGAGTAAACTCTTGGTTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020132.4-1698s21c1
Sequence:CCGGCAGTTATCTTGGGAACTTAACCTCGAGGTTAAGTTCCCAAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020132.4-1278s21c1
Sequence:CCGGTCGCAGACTGATAGGAGTAACCTCGAGGTTACTCCTATCAGTCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020132.4-976s21c1
Sequence:CCGGGACATGTGCGTGAGGAGATTTCTCGAGAAATCTCCTCACGCACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020132
AGPAT3 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-642s1c1
Sequence:CCGGGATTGTGTTCTGCAAGCGGAACTCGAGTTCCGCTTGCAGAACACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-1069s1c1
Sequence:CCGGGCGCTCCAGGAGATATATAATCTCGAGATTATATATCTCCTGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-909s1c1
Sequence:CCGGCCTGAACTTCAGAGGAAACAACTCGAGTTGTTTCCTCTGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-501s1c1
Sequence:CCGGCCTCAACCACAACTTCGAGATCTCGAGATCTCGAAGTTGTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-1319s1c1
Sequence:CCGGGCTACGGAAACCAAGAGTTTACTCGAGTAAACTCTTGGTTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020132.4-1698s21c1
Sequence:CCGGCAGTTATCTTGGGAACTTAACCTCGAGGTTAAGTTCCCAAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020132.4-1278s21c1
Sequence:CCGGTCGCAGACTGATAGGAGTAACCTCGAGGTTACTCCTATCAGTCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020132.4-976s21c1
Sequence:CCGGGACATGTGCGTGAGGAGATTTCTCGAGAAATCTCCTCACGCACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020132
AGPAT3 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-642s1c1
Sequence:CCGGGATTGTGTTCTGCAAGCGGAACTCGAGTTCCGCTTGCAGAACACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-1069s1c1
Sequence:CCGGGCGCTCCAGGAGATATATAATCTCGAGATTATATATCTCCTGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-909s1c1
Sequence:CCGGCCTGAACTTCAGAGGAAACAACTCGAGTTGTTTCCTCTGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-501s1c1
Sequence:CCGGCCTCAACCACAACTTCGAGATCTCGAGATCTCGAAGTTGTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020132.3-1319s1c1
Sequence:CCGGGCTACGGAAACCAAGAGTTTACTCGAGTAAACTCTTGGTTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020132.4-1698s21c1
Sequence:CCGGCAGTTATCTTGGGAACTTAACCTCGAGGTTAAGTTCCCAAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020132.4-1278s21c1
Sequence:CCGGTCGCAGACTGATAGGAGTAACCTCGAGGTTACTCCTATCAGTCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020132.4-976s21c1
Sequence:CCGGGACATGTGCGTGAGGAGATTTCTCGAGAAATCTCCTCACGCACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053014
VALIDATED
AGPAT3 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1321s1c1
Sequence:CCGGGCTGTGATTGAACACCCATAACTCGAGTTATGGGTGTTCAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1281s1c1
Sequence:CCGGGCTATGGCAACCAAGAGCTTACTCGAGTAAGCTCTTGGTTGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-604s1c1
Sequence:CCGGGATCGTATTCTGCAAACGGAACTCGAGTTCCGTTTGCAGAATACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1045s1c1
Sequence:CCGGGTACAAGCAGAAGGGTGTATTCTCGAGAATACACCCTTCTGCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-599s1c1
Sequence:CCGGCTAGAGATCGTATTCTGCAAACTCGAGTTTGCAGAATACGATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-1045s21c1
Sequence:CCGGGTACAAGCAGAAGGGTGTATTCTCGAGAATACACCCTTCTGCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-599s21c1
Sequence:CCGGCTAGAGATCGTATTCTGCAAACTCGAGTTTGCAGAATACGATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053014.3-1321s21c1
Sequence:CCGGGCTGTGATTGAACACCCATAACTCGAGTTATGGGTGTTCAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-1281s21c1
Sequence:CCGGGCTATGGCAACCAAGAGCTTACTCGAGTAAGCTCTTGGTTGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053014
VALIDATED
AGPAT3 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1321s1c1
Sequence:CCGGGCTGTGATTGAACACCCATAACTCGAGTTATGGGTGTTCAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1281s1c1
Sequence:CCGGGCTATGGCAACCAAGAGCTTACTCGAGTAAGCTCTTGGTTGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-604s1c1
Sequence:CCGGGATCGTATTCTGCAAACGGAACTCGAGTTCCGTTTGCAGAATACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1045s1c1
Sequence:CCGGGTACAAGCAGAAGGGTGTATTCTCGAGAATACACCCTTCTGCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-599s1c1
Sequence:CCGGCTAGAGATCGTATTCTGCAAACTCGAGTTTGCAGAATACGATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-1045s21c1
Sequence:CCGGGTACAAGCAGAAGGGTGTATTCTCGAGAATACACCCTTCTGCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-599s21c1
Sequence:CCGGCTAGAGATCGTATTCTGCAAACTCGAGTTTGCAGAATACGATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053014.3-1321s21c1
Sequence:CCGGGCTGTGATTGAACACCCATAACTCGAGTTATGGGTGTTCAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-1281s21c1
Sequence:CCGGGCTATGGCAACCAAGAGCTTACTCGAGTAAGCTCTTGGTTGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053014
VALIDATED
AGPAT3 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1321s1c1
Sequence:CCGGGCTGTGATTGAACACCCATAACTCGAGTTATGGGTGTTCAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1281s1c1
Sequence:CCGGGCTATGGCAACCAAGAGCTTACTCGAGTAAGCTCTTGGTTGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-604s1c1
Sequence:CCGGGATCGTATTCTGCAAACGGAACTCGAGTTCCGTTTGCAGAATACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-1045s1c1
Sequence:CCGGGTACAAGCAGAAGGGTGTATTCTCGAGAATACACCCTTCTGCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053014.2-599s1c1
Sequence:CCGGCTAGAGATCGTATTCTGCAAACTCGAGTTTGCAGAATACGATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-1045s21c1
Sequence:CCGGGTACAAGCAGAAGGGTGTATTCTCGAGAATACACCCTTCTGCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-599s21c1
Sequence:CCGGCTAGAGATCGTATTCTGCAAACTCGAGTTTGCAGAATACGATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053014.3-1321s21c1
Sequence:CCGGGCTGTGATTGAACACCCATAACTCGAGTTATGGGTGTTCAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053014.3-1281s21c1
Sequence:CCGGGCTATGGCAACCAAGAGCTTACTCGAGTAAGCTCTTGGTTGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks