EMAIL THIS PAGE TO A FRIEND

AGPAT4-IT1

AGPAT4 intronic transcript 1 (non-protein coding)

32 Gene Product Result for
Synonyms: C6orf59 NCRNA00241
Species: Human AGPAT4-IT1(79992)
UniProtKB ID: Q9H0P7, A7E1X1, Q2M1M7, Q5TEF2, Q9H5S5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024929 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024929 Rosetta Predictions human pricing
XR_017956 Rosetta Predictions human pricing
XR_040210 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239036 predicted 692
2 SASI_Hs01_00239037 predicted 1497
3 SASI_Hs01_00239038 predicted 1485
4 SASI_Hs01_00239039 predicted 1534
5 SASI_Hs01_00239040 predicted 792
6 SASI_Hs01_00239041 predicted 1490
7 SASI_Hs01_00239042 predicted 1515
8 SASI_Hs01_00239043 predicted 1282
9 SASI_Hs01_00239044 predicted 1369
10 SASI_Hs01_00239045 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495067 predicted 1469
2 SASI_Hs02_00495068 predicted 1377
3 SASI_Hs02_00495069 predicted 197
4 SASI_Hs02_00495070 predicted 786
5 SASI_Hs02_00495071 predicted 1483
6 SASI_Hs02_00495072 predicted 1498
7 SASI_Hs02_00495073 predicted 1265
8 SASI_Hs02_00495074 predicted 535
9 SASI_Hs02_00495075 predicted 428
10 SASI_Hs02_00495076 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516909 predicted 1468
2 SASI_Hs02_00516910 predicted 1386
3 SASI_Hs02_00516911 predicted 202
4 SASI_Hs02_00516912 predicted 779
5 SASI_Hs02_00516913 predicted 1482
6 SASI_Hs02_00516914 predicted 1495
7 SASI_Hs02_00516915 predicted 1268
8 SASI_Hs02_00516916 predicted 538
9 SASI_Hs02_00516917 predicted 432
10 SASI_Hs02_00516918 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024929
AGPAT4-IT1 MISSION shRNA Bacterial Glycerol Stock
AGPAT4 intronic transcript 1 (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024929.1-810s1c1
Sequence:CCGGGTCTTTAACAAGCCAGAGTCTCTCGAGAGACTCTGGCTTGTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1678s1c1
Sequence:CCGGGCAGAAAGCAAGAGAAAGGAACTCGAGTTCCTTTCTCTTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1674s1c1
Sequence:CCGGGAAGGCAGAAAGCAAGAGAAACTCGAGTTTCTCTTGCTTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1487s1c1
Sequence:CCGGCCACGTGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024929.1-843s1c1
Sequence:CCGGCATAAAGCCAGGGTTGTTGAACTCGAGTTCAACAACCCTGGCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024929
AGPAT4-IT1 MISSION shRNA shRNA Plasmid DNA
AGPAT4 intronic transcript 1 (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024929.1-810s1c1
Sequence:CCGGGTCTTTAACAAGCCAGAGTCTCTCGAGAGACTCTGGCTTGTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1678s1c1
Sequence:CCGGGCAGAAAGCAAGAGAAAGGAACTCGAGTTCCTTTCTCTTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1674s1c1
Sequence:CCGGGAAGGCAGAAAGCAAGAGAAACTCGAGTTTCTCTTGCTTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1487s1c1
Sequence:CCGGCCACGTGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024929.1-843s1c1
Sequence:CCGGCATAAAGCCAGGGTTGTTGAACTCGAGTTCAACAACCCTGGCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024929
AGPAT4-IT1 MISSION shRNA Lentiviral Transduction Particles
AGPAT4 intronic transcript 1 (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024929.1-810s1c1
Sequence:CCGGGTCTTTAACAAGCCAGAGTCTCTCGAGAGACTCTGGCTTGTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1678s1c1
Sequence:CCGGGCAGAAAGCAAGAGAAAGGAACTCGAGTTCCTTTCTCTTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1674s1c1
Sequence:CCGGGAAGGCAGAAAGCAAGAGAAACTCGAGTTTCTCTTGCTTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024929.1-1487s1c1
Sequence:CCGGCCACGTGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024929.1-843s1c1
Sequence:CCGGCATAAAGCCAGGGTTGTTGAACTCGAGTTCAACAACCCTGGCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks