EMAIL THIS PAGE TO A FRIEND

AGPAT4

1-acylglycerol-3-phosphate O-acyltransferase 4

Synonyms: 1-AGPAT4 LPAAT-delta dJ473J16.2
UniProtKB ID: Q9NRZ5, Q5TEF0
Gene ID:
Human(56895) Summary: This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(68262) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
Rat(170919) 1-acylglycerol-3-phosphate O-acyltransferase 4
sheep(101112654) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
domestic guinea pig(100732088) 1-acylglycerol-3-phosphate O-acyltransferase 4
naked mole-rat(101701125) 1-acylglycerol-3-phosphate O-acyltransferase 4
Zebrafish(406265) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
chicken(421578) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
cow(507456) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
domestic cat(101095498) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
dog(612306) 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020133 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012733 Rosetta Predictions human pricing
NM_001012734 Rosetta Predictions human pricing
NM_020133 Rosetta Predictions human pricing
NM_133406 Rosetta Predictions rat pricing
NM_026644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228895 predicted 1030
2 SASI_Hs01_00228896 predicted 576
3 SASI_Hs01_00228897 predicted 321
4 SASI_Hs01_00228898 predicted 606
5 SASI_Hs01_00228899 predicted 680
6 SASI_Hs01_00228900 predicted 571
7 SASI_Hs01_00228901 predicted 979
8 SASI_Hs01_00228902 predicted 304
9 SASI_Hs01_00228903 predicted 675
10 SASI_Hs01_00228904 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077538 predicted 724
2 SASI_Hs01_00077539 predicted 798
3 SASI_Hs01_00077540 predicted 806
4 SASI_Hs01_00077541 predicted 708
5 SASI_Hs01_00077542 predicted 800
6 SASI_Hs01_00077543 predicted 679
7 SASI_Hs01_00077544 predicted 828
8 SASI_Hs01_00077545 predicted 722
9 SASI_Hs01_00077546 predicted 741
10 SASI_Hs01_00077547 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353010 predicted 1279
2 SASI_Hs01_00246255 predicted 1280
3 SASI_Hs01_00246256 predicted 892
4 SASI_Hs02_00353011 predicted 309
5 SASI_Hs02_00353012 predicted 610
6 SASI_Hs01_00246263 predicted 838
7 SASI_Hs02_00353013 predicted 293
8 SASI_Hs02_00353014 predicted 741
9 SASI_Hs02_00353015 predicted 1416
10 SASI_Hs02_00353016 predicted 384
11 SASI_Hs01_00246254 predicted 951
12 SASI_Hs01_00246257 predicted 955
13 SASI_Hs01_00246258 predicted 960
14 SASI_Hs01_00246259 predicted 1402
15 SASI_Hs01_00246260 predicted 1336
16 SASI_Hs01_00246261 predicted 978
17 SASI_Hs01_00246262 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073106 predicted 606
2 SASI_Rn01_00073107 predicted 1260
3 SASI_Rn01_00073108 predicted 1323
4 SASI_Rn01_00073109 predicted 703
5 SASI_Rn01_00073110 predicted 565
6 SASI_Rn01_00073111 predicted 910
7 SASI_Rn01_00073112 predicted 855
8 SASI_Rn01_00073113 predicted 649
9 SASI_Rn01_00073114 predicted 868
10 SASI_Rn01_00073115 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079619 predicted 1340
2 SASI_Mm01_00079620 predicted 843
3 SASI_Mm01_00079622 predicted 1011
4 SASI_Mm02_00330641 predicted 614
5 SASI_Mm01_00079623 predicted 866
6 SASI_Mm01_00079624 predicted 922
7 SASI_Mm01_00079625 predicted 653
8 SASI_Mm01_00079626 predicted 493
9 SASI_Mm01_00079627 predicted 1269
10 SASI_Mm01_00079628 predicted 703
11 SASI_Mm01_00079621 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020133
VALIDATED
AGPAT4 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-952s21c1
Sequence:CCGGGAGTCCTAAACGGAAAGAAATCTCGAGATTTCTTTCCGTTTAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1637s21c1
Sequence:CCGGGTGATCATAGAAAGGGTATTTCTCGAGAAATACCCTTTCTATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1181s21c1
Sequence:CCGGGCTCTACCCTTTCTTCCAGTTCTCGAGAACTGGAAGAAAGGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-344s21c1
Sequence:CCGGGCCCATTAACAAGCAGCTCTTCTCGAGAAGAGCTGCTTGTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1290s21c1
Sequence:CCGGATGATTGGTGTGACGGAAATTCTCGAGAATTTCCGTCACACCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-532s1c1
Sequence:CCGGGCTGGCCTATGTCCCAATTATCTCGAGATAATTGGGACATAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020133.1-1111s1c1
Sequence:CCGGGCTCTACCCTTTCTTCCAGTTCTCGAGAACTGGAAGAAAGGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-274s1c1
Sequence:CCGGGCCCATTAACAAGCAGCTCTTCTCGAGAAGAGCTGCTTGTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020133.1-882s1c1
Sequence:CCGGGAGTCCTAAACGGAAAGAAATCTCGAGATTTCTTTCCGTTTAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-430s1c1
Sequence:CCGGCGTGGTTCTCAACCACAAGTTCTCGAGAACTTGTGGTTGAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020133
VALIDATED
AGPAT4 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-952s21c1
Sequence:CCGGGAGTCCTAAACGGAAAGAAATCTCGAGATTTCTTTCCGTTTAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1637s21c1
Sequence:CCGGGTGATCATAGAAAGGGTATTTCTCGAGAAATACCCTTTCTATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1181s21c1
Sequence:CCGGGCTCTACCCTTTCTTCCAGTTCTCGAGAACTGGAAGAAAGGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-344s21c1
Sequence:CCGGGCCCATTAACAAGCAGCTCTTCTCGAGAAGAGCTGCTTGTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1290s21c1
Sequence:CCGGATGATTGGTGTGACGGAAATTCTCGAGAATTTCCGTCACACCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-532s1c1
Sequence:CCGGGCTGGCCTATGTCCCAATTATCTCGAGATAATTGGGACATAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020133.1-1111s1c1
Sequence:CCGGGCTCTACCCTTTCTTCCAGTTCTCGAGAACTGGAAGAAAGGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-274s1c1
Sequence:CCGGGCCCATTAACAAGCAGCTCTTCTCGAGAAGAGCTGCTTGTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020133.1-882s1c1
Sequence:CCGGGAGTCCTAAACGGAAAGAAATCTCGAGATTTCTTTCCGTTTAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-430s1c1
Sequence:CCGGCGTGGTTCTCAACCACAAGTTCTCGAGAACTTGTGGTTGAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020133
VALIDATED
AGPAT4 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-952s21c1
Sequence:CCGGGAGTCCTAAACGGAAAGAAATCTCGAGATTTCTTTCCGTTTAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1637s21c1
Sequence:CCGGGTGATCATAGAAAGGGTATTTCTCGAGAAATACCCTTTCTATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1181s21c1
Sequence:CCGGGCTCTACCCTTTCTTCCAGTTCTCGAGAACTGGAAGAAAGGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-344s21c1
Sequence:CCGGGCCCATTAACAAGCAGCTCTTCTCGAGAAGAGCTGCTTGTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020133.2-1290s21c1
Sequence:CCGGATGATTGGTGTGACGGAAATTCTCGAGAATTTCCGTCACACCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-532s1c1
Sequence:CCGGGCTGGCCTATGTCCCAATTATCTCGAGATAATTGGGACATAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020133.1-1111s1c1
Sequence:CCGGGCTCTACCCTTTCTTCCAGTTCTCGAGAACTGGAAGAAAGGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-274s1c1
Sequence:CCGGGCCCATTAACAAGCAGCTCTTCTCGAGAAGAGCTGCTTGTTAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020133.1-882s1c1
Sequence:CCGGGAGTCCTAAACGGAAAGAAATCTCGAGATTTCTTTCCGTTTAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020133.1-430s1c1
Sequence:CCGGCGTGGTTCTCAACCACAAGTTCTCGAGAACTTGTGGTTGAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026644
AGPAT4 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-871s21c1
Sequence:CCGGATGTTGTCCCAGCTGTATATGCTCGAGCATATACAGCTGGGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026644.2-1549s21c1
Sequence:CCGGTGTGATATGGTTTCGGTTATGCTCGAGCATAACCGAAACCATATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.2-614s1c1
Sequence:CCGGGATGTGGTACTTCGTGGAAATCTCGAGATTTCCACGAAGTACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.2-833s1c1
Sequence:CCGGCACCAAAGGCTTTGCTATTACCTCGAGGTAATAGCAAAGCCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-925s21c1
Sequence:CCGGCAACACTGCTGGGAGTCTTAACTCGAGTTAAGACTCCCAGCAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-614s21c1
Sequence:CCGGGATGTGGTACTTCGTGGAAATCTCGAGATTTCCACGAAGTACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-833s21c1
Sequence:CCGGCACCAAAGGCTTTGCTATTACCTCGAGGTAATAGCAAAGCCTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-492s1c1
Sequence:CCGGCCTCAATCACAAGTTTGAGATCTCGAGATCTCAAACTTGTGATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-577s1c1
Sequence:CCGGGCCAAGAAAGAACTGGCTTATCTCGAGATAAGCCAGTTCTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-933s1c1
Sequence:CCGGGCTGGGAGTCTTAAATGGAAACTCGAGTTTCCATTTAAGACTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026644
AGPAT4 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-871s21c1
Sequence:CCGGATGTTGTCCCAGCTGTATATGCTCGAGCATATACAGCTGGGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026644.2-1549s21c1
Sequence:CCGGTGTGATATGGTTTCGGTTATGCTCGAGCATAACCGAAACCATATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.2-614s1c1
Sequence:CCGGGATGTGGTACTTCGTGGAAATCTCGAGATTTCCACGAAGTACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.2-833s1c1
Sequence:CCGGCACCAAAGGCTTTGCTATTACCTCGAGGTAATAGCAAAGCCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-925s21c1
Sequence:CCGGCAACACTGCTGGGAGTCTTAACTCGAGTTAAGACTCCCAGCAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-614s21c1
Sequence:CCGGGATGTGGTACTTCGTGGAAATCTCGAGATTTCCACGAAGTACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-833s21c1
Sequence:CCGGCACCAAAGGCTTTGCTATTACCTCGAGGTAATAGCAAAGCCTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-492s1c1
Sequence:CCGGCCTCAATCACAAGTTTGAGATCTCGAGATCTCAAACTTGTGATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-577s1c1
Sequence:CCGGGCCAAGAAAGAACTGGCTTATCTCGAGATAAGCCAGTTCTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-933s1c1
Sequence:CCGGGCTGGGAGTCTTAAATGGAAACTCGAGTTTCCATTTAAGACTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026644
AGPAT4 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-871s21c1
Sequence:CCGGATGTTGTCCCAGCTGTATATGCTCGAGCATATACAGCTGGGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026644.2-1549s21c1
Sequence:CCGGTGTGATATGGTTTCGGTTATGCTCGAGCATAACCGAAACCATATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.2-614s1c1
Sequence:CCGGGATGTGGTACTTCGTGGAAATCTCGAGATTTCCACGAAGTACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.2-833s1c1
Sequence:CCGGCACCAAAGGCTTTGCTATTACCTCGAGGTAATAGCAAAGCCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-925s21c1
Sequence:CCGGCAACACTGCTGGGAGTCTTAACTCGAGTTAAGACTCCCAGCAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-614s21c1
Sequence:CCGGGATGTGGTACTTCGTGGAAATCTCGAGATTTCCACGAAGTACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026644.2-833s21c1
Sequence:CCGGCACCAAAGGCTTTGCTATTACCTCGAGGTAATAGCAAAGCCTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-492s1c1
Sequence:CCGGCCTCAATCACAAGTTTGAGATCTCGAGATCTCAAACTTGTGATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-577s1c1
Sequence:CCGGGCCAAGAAAGAACTGGCTTATCTCGAGATAAGCCAGTTCTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026644.1-933s1c1
Sequence:CCGGGCTGGGAGTCTTAAATGGAAACTCGAGTTTCCATTTAAGACTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks