EMAIL THIS PAGE TO A FRIEND

AGPAT5

1-acylglycerol-3-phosphate O-acyltransferase 5

Synonyms: 1AGPAT5 LPAATE
UniProtKB ID: Q9NUQ2, Q8IZ47, Q9BQG4
Gene ID:
Human(55326) Summary: This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(52123) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
Rat(306582) 1-acylglycerol-3-phosphate O-acyltransferase 5
Zebrafish(767778) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
chicken(421898) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
cow(530414) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
domestic cat(101082814) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
dog(100684122) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
naked mole-rat(101712496) 1-acylglycerol-3-phosphate O-acyltransferase 5
domestic guinea pig(100720934) 1-acylglycerol-3-phosphate O-acyltransferase 5
sheep(101103870) 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018361 Rosetta Predictions human pricing
NM_001134744 Rosetta Predictions rat pricing
NM_026792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022961 predicted 1045
2 SASI_Hs02_00351824 predicted 1088
3 SASI_Hs01_00022964 predicted 1169
4 SASI_Hs01_00022965 predicted 1158
5 SASI_Hs01_00022966 predicted 1289
6 SASI_Hs01_00022968 predicted 1263
7 SASI_Hs01_00022969 predicted 917
8 SASI_Hs02_00351825 predicted 833
9 SASI_Hs01_00022970 predicted 1148
10 SASI_Hs02_00351826 predicted 964
11 SASI_Hs01_00022962 predicted 1097
12 SASI_Hs01_00022963 predicted 1339
13 SASI_Hs01_00022967 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258294 predicted 866
2 SASI_Rn02_00258295 predicted 352
3 SASI_Rn02_00258296 predicted 900
4 SASI_Rn02_00258297 predicted 515
5 SASI_Rn02_00258298 predicted 808
6 SASI_Rn02_00258299 predicted 234
7 SASI_Rn02_00258300 predicted 650
8 SASI_Rn02_00258301 predicted 365
9 SASI_Rn02_00258302 predicted 381
10 SASI_Rn02_00258303 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022120 predicted 931
2 SASI_Mm02_00330904 predicted 1061
3 SASI_Mm01_00022121 predicted 497
4 SASI_Mm01_00022122 predicted 736
5 SASI_Mm01_00022123 predicted 802
6 SASI_Mm02_00330905 predicted 1226
7 SASI_Mm01_00022125 predicted 1153
8 SASI_Mm02_00330906 predicted 669
9 SASI_Mm01_00022127 predicted 970
10 SASI_Mm01_00022128 predicted 744
11 SASI_Mm01_00022124 predicted 879
12 SASI_Mm01_00022126 predicted 411
13 SASI_Mm01_00022129 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018361
VALIDATED
AGPAT5 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_018361.1-1005s1c1
Sequence:CCGGGCTGTATGTGAACACCTGGATCTCGAGATCCAGGTGTTCACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_018361.1-719s1c1
Sequence:CCGGCGGAATTTCTCTGCAAAGAATCTCGAGATTCTTTGCAGAGAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-351s1c1
Sequence:CCGGGCTGCCATTGTATGGGTGTTACTCGAGTAACACCCATACAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-528s1c1
Sequence:CCGGCCTTTCAGCTAGTCAGGCATTCTCGAGAATGCCTGACTAGCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-162s1c1
Sequence:CCGGGCTCTTCTTCTTCGAGAATTACTCGAGTAATTCTCGAAGAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-1043s21c1
Sequence:CCGGCACCGACCATGACGGAATTTCCTCGAGGAAATTCCGTCATGGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-826s21c1
Sequence:CCGGCCAGAAGGTACAAGGTATAATCTCGAGATTATACCTTGTACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018361.3-3093s21c1
Sequence:CCGGAGGATATAGTTGGCCTAATAACTCGAGTTATTAGGCCAACTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-1381s21c1
Sequence:CCGGTGCCTGTGGGTTACTATTAAACTCGAGTTTAATAGTAACCCACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-919s21c1
Sequence:CCGGGTGCTAACACCACGAATAAAGCTCGAGCTTTATTCGTGGTGTTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018361
VALIDATED
AGPAT5 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_018361.1-1005s1c1
Sequence:CCGGGCTGTATGTGAACACCTGGATCTCGAGATCCAGGTGTTCACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_018361.1-719s1c1
Sequence:CCGGCGGAATTTCTCTGCAAAGAATCTCGAGATTCTTTGCAGAGAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-351s1c1
Sequence:CCGGGCTGCCATTGTATGGGTGTTACTCGAGTAACACCCATACAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-528s1c1
Sequence:CCGGCCTTTCAGCTAGTCAGGCATTCTCGAGAATGCCTGACTAGCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-162s1c1
Sequence:CCGGGCTCTTCTTCTTCGAGAATTACTCGAGTAATTCTCGAAGAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-1043s21c1
Sequence:CCGGCACCGACCATGACGGAATTTCCTCGAGGAAATTCCGTCATGGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-826s21c1
Sequence:CCGGCCAGAAGGTACAAGGTATAATCTCGAGATTATACCTTGTACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018361.3-3093s21c1
Sequence:CCGGAGGATATAGTTGGCCTAATAACTCGAGTTATTAGGCCAACTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-1381s21c1
Sequence:CCGGTGCCTGTGGGTTACTATTAAACTCGAGTTTAATAGTAACCCACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-919s21c1
Sequence:CCGGGTGCTAACACCACGAATAAAGCTCGAGCTTTATTCGTGGTGTTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018361
VALIDATED
AGPAT5 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_018361.1-1005s1c1
Sequence:CCGGGCTGTATGTGAACACCTGGATCTCGAGATCCAGGTGTTCACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_018361.1-719s1c1
Sequence:CCGGCGGAATTTCTCTGCAAAGAATCTCGAGATTCTTTGCAGAGAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-351s1c1
Sequence:CCGGGCTGCCATTGTATGGGTGTTACTCGAGTAACACCCATACAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-528s1c1
Sequence:CCGGCCTTTCAGCTAGTCAGGCATTCTCGAGAATGCCTGACTAGCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018361.1-162s1c1
Sequence:CCGGGCTCTTCTTCTTCGAGAATTACTCGAGTAATTCTCGAAGAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-1043s21c1
Sequence:CCGGCACCGACCATGACGGAATTTCCTCGAGGAAATTCCGTCATGGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-826s21c1
Sequence:CCGGCCAGAAGGTACAAGGTATAATCTCGAGATTATACCTTGTACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018361.3-3093s21c1
Sequence:CCGGAGGATATAGTTGGCCTAATAACTCGAGTTATTAGGCCAACTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-1381s21c1
Sequence:CCGGTGCCTGTGGGTTACTATTAAACTCGAGTTTAATAGTAACCCACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018361.3-919s21c1
Sequence:CCGGGTGCTAACACCACGAATAAAGCTCGAGCTTTATTCGTGGTGTTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026792
VALIDATED
AGPAT5 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-887s21c1
Sequence:GTACCGGCGTACTGACACCAAGAATAAACTCGAGTTTATTCTTGGTGTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026792.3-2173s21c1
Sequence:GTACCGGTGAGCCGTTAAGTACTTATAACTCGAGTTATAAGTACTTAACGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-632s21c1
Sequence:GTACCGGCGTACTGAAAGACAAGTTAAACTCGAGTTTAACTTGTCTTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-938s21c1
Sequence:CCGGGAGTCATTTAGATGCAATTTACTCGAGTAAATTGCATCTAAATGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-763s21c1
Sequence:CCGGACGCAGGAACACCGATGTATCCTCGAGGATACATCGGTGTTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026792
VALIDATED
AGPAT5 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-887s21c1
Sequence:GTACCGGCGTACTGACACCAAGAATAAACTCGAGTTTATTCTTGGTGTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026792.3-2173s21c1
Sequence:GTACCGGTGAGCCGTTAAGTACTTATAACTCGAGTTATAAGTACTTAACGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-632s21c1
Sequence:GTACCGGCGTACTGAAAGACAAGTTAAACTCGAGTTTAACTTGTCTTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-938s21c1
Sequence:CCGGGAGTCATTTAGATGCAATTTACTCGAGTAAATTGCATCTAAATGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-763s21c1
Sequence:CCGGACGCAGGAACACCGATGTATCCTCGAGGATACATCGGTGTTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026792
VALIDATED
AGPAT5 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-887s21c1
Sequence:GTACCGGCGTACTGACACCAAGAATAAACTCGAGTTTATTCTTGGTGTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026792.3-2173s21c1
Sequence:GTACCGGTGAGCCGTTAAGTACTTATAACTCGAGTTATAAGTACTTAACGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-632s21c1
Sequence:GTACCGGCGTACTGAAAGACAAGTTAAACTCGAGTTTAACTTGTCTTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-938s21c1
Sequence:CCGGGAGTCATTTAGATGCAATTTACTCGAGTAAATTGCATCTAAATGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026792.3-763s21c1
Sequence:CCGGACGCAGGAACACCGATGTATCCTCGAGGATACATCGGTGTTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks