EMAIL THIS PAGE TO A FRIEND

AGPAT6

1-acylglycerol-3-phosphate O-acyltransferase 6

53 Gene Product Result for
Synonyms: 1-AGPAT 6 LPAAT-zeta LPAATZ TSARG7
UniProtKB ID: Q86UL3, Q86V89
Gene ID:
Human(137964) Summary: Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
Mouse(102247) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
Rat(290843) 1-acylglycerol-3-phosphate O-acyltransferase 6
Zebrafish(678522) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
chicken(426788) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
dog(475572) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
domestic cat(101082396) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
cow(511614) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
Horse(100050446) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
Goat(100861270) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
sheep(101117217) 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
domestic guinea pig(100721768) 1-acylglycerol-3-phosphate O-acyltransferase 6
naked mole-rat(101717224) 1-acylglycerol-3-phosphate O-acyltransferase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178819 Rosetta Predictions human pricing
NM_001047849 Rosetta Predictions rat pricing
NM_018743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369859 predicted 1950
2 SASI_Hs01_00206614 predicted 1366
3 SASI_Hs01_00206615 predicted 1736
4 SASI_Hs01_00206616 predicted 1792
5 SASI_Hs01_00206617 predicted 1457
6 SASI_Hs01_00206618 predicted 2103
7 SASI_Hs02_00369860 predicted 1157
8 SASI_Hs01_00206621 predicted 1478
9 SASI_Hs01_00206622 predicted 1655
10 SASI_Hs01_00206623 predicted 2097
11 SASI_Hs01_00206619 predicted 1177
12 SASI_Hs01_00206620 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206165 predicted 1368
2 SASI_Rn02_00206166 predicted 1979
3 SASI_Rn02_00206167 predicted 2026
4 SASI_Rn02_00206168 predicted 1294
5 SASI_Rn02_00206169 predicted 1931
6 SASI_Rn02_00206170 predicted 1551
7 SASI_Rn02_00206171 predicted 1280
8 SASI_Rn02_00206172 predicted 1737
9 SASI_Rn02_00206173 predicted 1462
10 SASI_Rn02_00206174 predicted 1972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021693 predicted 1157
2 SASI_Mm01_00021694 predicted 1676
3 SASI_Mm01_00021695 predicted 1453
4 SASI_Mm02_00324002 predicted 1424
5 SASI_Mm01_00021696 predicted 1229
6 SASI_Mm01_00021697 predicted 1681
7 SASI_Mm01_00021698 predicted 2016
8 SASI_Mm01_00021699 predicted 2255
9 SASI_Mm01_00021700 predicted 1485
10 SASI_Mm01_00021701 predicted 1576
11 SASI_Mm01_00021692 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178819
VALIDATED
AGPAT6 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-2132s21c1
Sequence:CCGGATGCTGTCCAGTTTGCGAATACTCGAGTATTCGCAAACTGGACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1374s21c1
Sequence:CCGGGCTGAGCAGAACCAATTATAACTCGAGTTATAATTGGTTCTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1225s21c1
Sequence:CCGGCGTCGAAGTGGTAGTAGTAAGCTCGAGCTTACTACTACCACTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1163s21c1
Sequence:CCGGCCTACACCAACGGAATCATTGCTCGAGCAATGATTCCGTTGGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178819.3-2662s21c1
Sequence:CCGGGGCGGTACAAGAGTCTGTTATCTCGAGATAACAGACTCTTGTACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178819.2-1955s1c1
Sequence:CCGGCCACAGTTTACCCTGTTGCTACTCGAGTAGCAACAGGGTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178819.2-1973s1c1
Sequence:CCGGCTATCAAGTATGACCCTCAATCTCGAGATTGAGGGTCATACTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_178819.2-1873s1c1
Sequence:CCGGCCTATCCTCATCTTCCCAGAACTCGAGTTCTGGGAAGATGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178819
VALIDATED
AGPAT6 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-2132s21c1
Sequence:CCGGATGCTGTCCAGTTTGCGAATACTCGAGTATTCGCAAACTGGACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1374s21c1
Sequence:CCGGGCTGAGCAGAACCAATTATAACTCGAGTTATAATTGGTTCTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1225s21c1
Sequence:CCGGCGTCGAAGTGGTAGTAGTAAGCTCGAGCTTACTACTACCACTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1163s21c1
Sequence:CCGGCCTACACCAACGGAATCATTGCTCGAGCAATGATTCCGTTGGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178819.3-2662s21c1
Sequence:CCGGGGCGGTACAAGAGTCTGTTATCTCGAGATAACAGACTCTTGTACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178819.2-1955s1c1
Sequence:CCGGCCACAGTTTACCCTGTTGCTACTCGAGTAGCAACAGGGTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178819.2-1973s1c1
Sequence:CCGGCTATCAAGTATGACCCTCAATCTCGAGATTGAGGGTCATACTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_178819.2-1873s1c1
Sequence:CCGGCCTATCCTCATCTTCCCAGAACTCGAGTTCTGGGAAGATGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178819
VALIDATED
AGPAT6 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-2132s21c1
Sequence:CCGGATGCTGTCCAGTTTGCGAATACTCGAGTATTCGCAAACTGGACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1374s21c1
Sequence:CCGGGCTGAGCAGAACCAATTATAACTCGAGTTATAATTGGTTCTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1225s21c1
Sequence:CCGGCGTCGAAGTGGTAGTAGTAAGCTCGAGCTTACTACTACCACTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178819.3-1163s21c1
Sequence:CCGGCCTACACCAACGGAATCATTGCTCGAGCAATGATTCCGTTGGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178819.3-2662s21c1
Sequence:CCGGGGCGGTACAAGAGTCTGTTATCTCGAGATAACAGACTCTTGTACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178819.2-1955s1c1
Sequence:CCGGCCACAGTTTACCCTGTTGCTACTCGAGTAGCAACAGGGTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178819.2-1973s1c1
Sequence:CCGGCTATCAAGTATGACCCTCAATCTCGAGATTGAGGGTCATACTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_178819.2-1873s1c1
Sequence:CCGGCCTATCCTCATCTTCCCAGAACTCGAGTTCTGGGAAGATGAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018743
VALIDATED
AGPAT6 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-2281s21c1
Sequence:CCGGGCAGAAGCTATATAGCAAGATCTCGAGATCTTGCTATATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1564s21c1
Sequence:CCGGCCTGCCAAATGGGAGATTTAACTCGAGTTAAATCTCCCATTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1067s21c1
Sequence:CCGGGCCATCTTTGGAGTGTCCTTTCTCGAGAAAGGACACTCCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1190s21c1
Sequence:CCGGCCCTACACCAACGGAATCATTCTCGAGAATGATTCCGTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018743.4-2914s21c1
Sequence:CCGGCCCACATGACTTGTTTAATATCTCGAGATATTAAACAAGTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-2809s1c1
Sequence:CCGGCCCACATGACTTGTTTAATATCTCGAGATATTAAACAAGTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-1084s1c1
Sequence:CCGGCCCTACACCAACGGAATCATTCTCGAGAATGATTCCGTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-961s1c1
Sequence:CCGGGCCATCTTTGGAGTGTCCTTTCTCGAGAAAGGACACTCCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-1458s1c1
Sequence:CCGGCCTGCCAAATGGGAGATTTAACTCGAGTTAAATCTCCCATTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-2175s1c1
Sequence:CCGGGCAGAAGCTATATAGCAAGATCTCGAGATCTTGCTATATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018743
VALIDATED
AGPAT6 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-2281s21c1
Sequence:CCGGGCAGAAGCTATATAGCAAGATCTCGAGATCTTGCTATATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1564s21c1
Sequence:CCGGCCTGCCAAATGGGAGATTTAACTCGAGTTAAATCTCCCATTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1067s21c1
Sequence:CCGGGCCATCTTTGGAGTGTCCTTTCTCGAGAAAGGACACTCCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1190s21c1
Sequence:CCGGCCCTACACCAACGGAATCATTCTCGAGAATGATTCCGTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018743.4-2914s21c1
Sequence:CCGGCCCACATGACTTGTTTAATATCTCGAGATATTAAACAAGTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-2809s1c1
Sequence:CCGGCCCACATGACTTGTTTAATATCTCGAGATATTAAACAAGTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-1084s1c1
Sequence:CCGGCCCTACACCAACGGAATCATTCTCGAGAATGATTCCGTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-961s1c1
Sequence:CCGGGCCATCTTTGGAGTGTCCTTTCTCGAGAAAGGACACTCCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-1458s1c1
Sequence:CCGGCCTGCCAAATGGGAGATTTAACTCGAGTTAAATCTCCCATTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-2175s1c1
Sequence:CCGGGCAGAAGCTATATAGCAAGATCTCGAGATCTTGCTATATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018743
VALIDATED
AGPAT6 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-2281s21c1
Sequence:CCGGGCAGAAGCTATATAGCAAGATCTCGAGATCTTGCTATATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1564s21c1
Sequence:CCGGCCTGCCAAATGGGAGATTTAACTCGAGTTAAATCTCCCATTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1067s21c1
Sequence:CCGGGCCATCTTTGGAGTGTCCTTTCTCGAGAAAGGACACTCCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018743.4-1190s21c1
Sequence:CCGGCCCTACACCAACGGAATCATTCTCGAGAATGATTCCGTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018743.4-2914s21c1
Sequence:CCGGCCCACATGACTTGTTTAATATCTCGAGATATTAAACAAGTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-2809s1c1
Sequence:CCGGCCCACATGACTTGTTTAATATCTCGAGATATTAAACAAGTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-1084s1c1
Sequence:CCGGCCCTACACCAACGGAATCATTCTCGAGAATGATTCCGTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-961s1c1
Sequence:CCGGGCCATCTTTGGAGTGTCCTTTCTCGAGAAAGGACACTCCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-1458s1c1
Sequence:CCGGCCTGCCAAATGGGAGATTTAACTCGAGTTAAATCTCCCATTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018743.2-2175s1c1
Sequence:CCGGGCAGAAGCTATATAGCAAGATCTCGAGATCTTGCTATATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks