EMAIL THIS PAGE TO A FRIEND

AGPAT9

1-acylglycerol-3-phosphate O-acyltransferase 9

Synonyms: AGPAT8 GPAT3 LPAAT-theta MAG1
UniProtKB ID: Q53EU6, Q68CJ4, Q6GPI6, Q96NA3
Gene ID:
Human(84803) Summary: This gene encodes a member of the lysophosphatidic acid acyltransferase protein family. The encoded protein is an enzyme which catalyzes the conversion of glycerol-3-phosphate to lysophosphatidic acid in the synthesis of triacylglycerol. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
Mouse(231510) 1-acylglycerol-3-phosphate O-acyltransferase 9
Rat(305166) 1-acylglycerol-3-phosphate O-acyltransferase 9
naked mole-rat(101723615) 1-acylglycerol-3-phosphate O-acyltransferase 9
domestic guinea pig(100720788) 1-acylglycerol-3-phosphate O-acyltransferase 9
sheep(101119394) 1-acylglycerol-3-phosphate O-acyltransferase 9
Domestic Rabbit(100348761) 1-acylglycerol-3-phosphate O-acyltransferase 9
Zebrafish(436958) 1-acylglycerol-3-phosphate O-acyltransferase 9
chicken(422610) 1-acylglycerol-3-phosphate O-acyltransferase 9
dog(478460) 1-acylglycerol-3-phosphate O-acyltransferase 9
cow(519739) 1-acylglycerol-3-phosphate O-acyltransferase 9
Horse(100061623) 1-acylglycerol-3-phosphate O-acyltransferase 9
domestic cat(101083673) 1-acylglycerol-3-phosphate O-acyltransferase 9
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032717 Rosetta Predictions human pricing
NM_001025670 Rosetta Predictions rat pricing
NM_001035278 Rosetta Predictions mouse pricing
NM_172715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173386 predicted 1026
2 SASI_Hs02_00360250 predicted 321
3 SASI_Hs01_00173388 predicted 956
4 SASI_Hs01_00173389 predicted 880
5 SASI_Hs01_00173390 predicted 1093
6 SASI_Hs01_00173391 predicted 618
7 SASI_Hs01_00173392 predicted 704
8 SASI_Hs01_00173393 predicted 880
9 SASI_Hs01_00173394 predicted 876
10 SASI_Hs02_00360251 predicted 928
11 SASI_Hs01_00173387 predicted 506
12 SASI_Hs01_00173395 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088152 predicted 1269
2 SASI_Rn01_00088153 predicted 1226
3 SASI_Rn01_00088154 predicted 500
4 SASI_Rn02_00203259 predicted 1423
5 SASI_Rn01_00088156 predicted 1083
6 SASI_Rn01_00088157 predicted 1344
7 SASI_Rn01_00088159 predicted 466
8 SASI_Rn01_00088160 predicted 686
9 SASI_Rn01_00088161 predicted 1025
10 SASI_Rn02_00203260 predicted 1254
11 SASI_Rn01_00088155 predicted 1308
12 SASI_Rn01_00088158 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046107 predicted 782
2 SASI_Mm01_00046108 predicted 1283
3 SASI_Mm01_00046109 predicted 816
4 SASI_Mm01_00046110 predicted 838
5 SASI_Mm01_00046111 predicted 709
6 SASI_Mm01_00046112 predicted 825
7 SASI_Mm01_00046113 predicted 837
8 SASI_Mm01_00046114 predicted 796
9 SASI_Mm01_00046115 predicted 1337
10 SASI_Mm01_00046116 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344500 predicted 947
2 SASI_Mm02_00344501 predicted 382
3 SASI_Mm02_00344502 predicted 979
4 SASI_Mm02_00344503 predicted 1213
5 SASI_Mm01_00192821 predicted 669
6 SASI_Mm02_00344504 predicted 1122
7 SASI_Mm02_00344505 predicted 1067
8 SASI_Mm02_00344506 predicted 769
9 SASI_Mm02_00344507 predicted 1048
10 SASI_Mm02_00344508 predicted 804
11 SASI_Mm01_00192818 predicted 564
12 SASI_Mm01_00192819 predicted 1051
13 SASI_Mm01_00192820 predicted 591
14 SASI_Mm01_00192822 predicted 481
15 SASI_Mm01_00192823 predicted 596
16 SASI_Mm01_00192824 predicted 602
17 SASI_Mm01_00192825 predicted 568
18 SASI_Mm01_00192826 predicted 1113
19 SASI_Mm01_00192827 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172715
AGPAT9 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-908s1c1
Sequence:CCGGCCTCTCCCATTGATGTCCTAACTCGAGTTAGGACATCAATGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-725s1c1
Sequence:CCGGGCTTGCTGATTATAGGAACTACTCGAGTAGTTCCTATAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-1479s1c1
Sequence:CCGGGAAGAATTACAGCAAGATGATCTCGAGATCATCTTGCTGTAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172715.2-2341s1c1
Sequence:CCGGGCAGTGGAGAAAGCACTGTTACTCGAGTAACAGTGCTTTCTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-300s1c1
Sequence:CCGGCTTCGGATTATCCCTGGGTATCTCGAGATACCCAGGGATAATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172715
AGPAT9 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-908s1c1
Sequence:CCGGCCTCTCCCATTGATGTCCTAACTCGAGTTAGGACATCAATGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-725s1c1
Sequence:CCGGGCTTGCTGATTATAGGAACTACTCGAGTAGTTCCTATAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-1479s1c1
Sequence:CCGGGAAGAATTACAGCAAGATGATCTCGAGATCATCTTGCTGTAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172715.2-2341s1c1
Sequence:CCGGGCAGTGGAGAAAGCACTGTTACTCGAGTAACAGTGCTTTCTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-300s1c1
Sequence:CCGGCTTCGGATTATCCCTGGGTATCTCGAGATACCCAGGGATAATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172715
AGPAT9 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-908s1c1
Sequence:CCGGCCTCTCCCATTGATGTCCTAACTCGAGTTAGGACATCAATGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-725s1c1
Sequence:CCGGGCTTGCTGATTATAGGAACTACTCGAGTAGTTCCTATAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-1479s1c1
Sequence:CCGGGAAGAATTACAGCAAGATGATCTCGAGATCATCTTGCTGTAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172715.2-2341s1c1
Sequence:CCGGGCAGTGGAGAAAGCACTGTTACTCGAGTAACAGTGCTTTCTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172715.2-300s1c1
Sequence:CCGGCTTCGGATTATCCCTGGGTATCTCGAGATACCCAGGGATAATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032717
VALIDATED
AGPAT9 MISSION shRNA Bacterial Glycerol Stock
1-acylglycerol-3-phosphate O-acyltransferase 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-963s1c1
Sequence:CCGGCCTGGTTACTAAGAGACTAAACTCGAGTTTAGTCTCTTAGTAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-2112s1c1
Sequence:CCGGCCTTGTTTGAATGCTGTAGATCTCGAGATCTACAGCATTCAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-2147s1c1
Sequence:CCGGCCTCCCATCTACTGATTTGTTCTCGAGAACAAATCAGTAGATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-478s1c1
Sequence:CCGGGAGGAGCTAGTGTCATGGAATCTCGAGATTCCATGACACTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-294s1c1
Sequence:CCGGCCCAAAGGAGTCGATTCTTAACTCGAGTTAAGAATCGACTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-1002s1c1
Sequence:CCGGGAAGAAACTACCCATACTAATCTCGAGATTAGTATGGGTAGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-1463s1c1
Sequence:CCGGCCCTTAGAAATGGAATGGCTTCTCGAGAAGCCATTCCATTTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032717
VALIDATED
AGPAT9 MISSION shRNA shRNA Plasmid DNA
1-acylglycerol-3-phosphate O-acyltransferase 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-963s1c1
Sequence:CCGGCCTGGTTACTAAGAGACTAAACTCGAGTTTAGTCTCTTAGTAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-2112s1c1
Sequence:CCGGCCTTGTTTGAATGCTGTAGATCTCGAGATCTACAGCATTCAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-2147s1c1
Sequence:CCGGCCTCCCATCTACTGATTTGTTCTCGAGAACAAATCAGTAGATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-478s1c1
Sequence:CCGGGAGGAGCTAGTGTCATGGAATCTCGAGATTCCATGACACTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-294s1c1
Sequence:CCGGCCCAAAGGAGTCGATTCTTAACTCGAGTTAAGAATCGACTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-1002s1c1
Sequence:CCGGGAAGAAACTACCCATACTAATCTCGAGATTAGTATGGGTAGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-1463s1c1
Sequence:CCGGCCCTTAGAAATGGAATGGCTTCTCGAGAAGCCATTCCATTTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032717
VALIDATED
AGPAT9 MISSION shRNA Lentiviral Transduction Particles
1-acylglycerol-3-phosphate O-acyltransferase 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-963s1c1
Sequence:CCGGCCTGGTTACTAAGAGACTAAACTCGAGTTTAGTCTCTTAGTAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-2112s1c1
Sequence:CCGGCCTTGTTTGAATGCTGTAGATCTCGAGATCTACAGCATTCAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-2147s1c1
Sequence:CCGGCCTCCCATCTACTGATTTGTTCTCGAGAACAAATCAGTAGATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-478s1c1
Sequence:CCGGGAGGAGCTAGTGTCATGGAATCTCGAGATTCCATGACACTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-294s1c1
Sequence:CCGGCCCAAAGGAGTCGATTCTTAACTCGAGTTAAGAATCGACTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032717.3-1002s1c1
Sequence:CCGGGAAGAAACTACCCATACTAATCTCGAGATTAGTATGGGTAGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032717.3-1463s1c1
Sequence:CCGGCCCTTAGAAATGGAATGGCTTCTCGAGAAGCCATTCCATTTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks