EMAIL THIS PAGE TO A FRIEND

AGPS

alkylglycerone phosphate synthase

141 Gene Product Result for
Synonyms: ADAP-S ADAS ADHAPS ADPS ALDHPSY
UniProtKB ID: O00116, A5D8U9, Q2TU35
Gene ID:
Human(8540) Summary: This gene is a member of the FAD-binding oxidoreductase/transferase type 4 family. It encodes a protein that catalyzes the second step of ether lipid biosynthesis in which acyl-dihydroxyacetonephosphate (DHAP) is converted to alkyl-DHAP by the addition of a long chain alcohol and the removal of a long-chain acid anion. The protein is localized to the inner aspect of the peroxisomal membrane and requires FAD as a cofactor. Mutations in this gene have been associated with rhizomelic chondrodysplasia punctata, type 3 and Zellweger syndrome. [provided by RefSeq, Jul 2008]
Mouse(228061) alkylglycerone phosphate synthase
Rat(84114) alkylglycerone phosphate synthase
sheep(101104553) alkylglycerone phosphate synthase
Domestic Rabbit(100353420) alkylglycerone phosphate synthase
domestic guinea pig(100734021) alkylglycerone phosphate synthase
naked mole-rat(101699622) alkylglycerone phosphate synthase
Zebrafish(386801) alkylglycerone phosphate synthase
cow(613679) alkylglycerone phosphate synthase
domestic cat(101094364) alkylglycerone phosphate synthase
dog(488421) alkylglycerone phosphate synthase
chicken(424135) alkylglycerone phosphate synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003659 Rosetta Predictions human pricing
NM_053350 Rosetta Predictions rat pricing
XM_001070306 Rosetta Predictions rat pricing
NM_172666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188331 predicted 905
2 SASI_Hs01_00188332 predicted 899
3 SASI_Hs01_00188333 predicted 984
4 SASI_Hs02_00336040 predicted 1445
5 SASI_Hs01_00188334 predicted 775
6 SASI_Hs01_00188335 predicted 530
7 SASI_Hs01_00188336 predicted 634
8 SASI_Hs01_00188337 predicted 1263
9 SASI_Hs01_00188338 predicted 844
10 SASI_Hs01_00188339 predicted 809
11 SASI_Hs01_00188340 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102601 predicted 825
2 SASI_Rn01_00102602 predicted 615
3 SASI_Rn01_00102603 predicted 1030
4 SASI_Rn01_00102604 predicted 1661
5 SASI_Rn02_00265815 predicted 1595
6 SASI_Rn01_00102606 predicted 967
7 SASI_Rn01_00102607 predicted 1467
8 SASI_Rn01_00102608 predicted 1400
9 SASI_Rn01_00102609 predicted 705
10 SASI_Rn01_00102610 predicted 830
11 SASI_Rn01_00102605 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331178 predicted 30
2 SASI_Rn02_00331179 predicted 29
3 SASI_Rn02_00331180 predicted 32
4 SASI_Rn02_00331181 predicted 282
5 SASI_Rn02_00331182 predicted 163
6 SASI_Rn02_00331183 predicted 153
7 SASI_Rn02_00331184 predicted 150
8 SASI_Rn02_00331185 predicted 203
9 SASI_Rn02_00331186 predicted 57
10 SASI_Rn02_00331187 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052369 predicted 918
2 SASI_Mm01_00052370 predicted 1765
3 SASI_Mm02_00344377 predicted 1071
4 SASI_Mm01_00052371 predicted 1564
5 SASI_Mm01_00052372 predicted 1572
6 SASI_Mm01_00052373 predicted 2083
7 SASI_Mm01_00052374 predicted 1506
8 SASI_Mm01_00052375 predicted 932
9 SASI_Mm01_00052377 predicted 1583
10 SASI_Mm01_00052378 predicted 1454
11 SASI_Mm01_00052376 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172666
VALIDATED
AGPS MISSION shRNA Bacterial Glycerol Stock
alkylglycerone phosphate synthase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-526s1c1
Sequence:CCGGCCTCCTTCTATTGTGAATGAACTCGAGTTCATTCACAATAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172666.2-2424s1c1
Sequence:CCGGGCAGATAATCTAGCAAAGATTCTCGAGAATCTTTGCTAGATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-2001s1c1
Sequence:CCGGCCCAAGTAACATCTTTGGAAACTCGAGTTTCCAAAGATGTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-1578s1c1
Sequence:CCGGGCTGACTTATGTCATTGCATACTCGAGTATGCAATGACATAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-898s1c1
Sequence:CCGGGCTGGGATAACAGGACAAGATCTCGAGATCTTGTCCTGTTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172666.2-2282s21c1
Sequence:CCGGAGCACAAGGCTGCCCATTATCCTCGAGGATAATGGGCAGCCTTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172666.2-623s21c1
Sequence:CCGGGTCATTGTCTTCACGAGATATCTCGAGATATCTCGTGAAGACAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172666
VALIDATED
AGPS MISSION shRNA shRNA Plasmid DNA
alkylglycerone phosphate synthase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-526s1c1
Sequence:CCGGCCTCCTTCTATTGTGAATGAACTCGAGTTCATTCACAATAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172666.2-2424s1c1
Sequence:CCGGGCAGATAATCTAGCAAAGATTCTCGAGAATCTTTGCTAGATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-2001s1c1
Sequence:CCGGCCCAAGTAACATCTTTGGAAACTCGAGTTTCCAAAGATGTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-1578s1c1
Sequence:CCGGGCTGACTTATGTCATTGCATACTCGAGTATGCAATGACATAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-898s1c1
Sequence:CCGGGCTGGGATAACAGGACAAGATCTCGAGATCTTGTCCTGTTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172666.2-2282s21c1
Sequence:CCGGAGCACAAGGCTGCCCATTATCCTCGAGGATAATGGGCAGCCTTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172666.2-623s21c1
Sequence:CCGGGTCATTGTCTTCACGAGATATCTCGAGATATCTCGTGAAGACAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172666
VALIDATED
AGPS MISSION shRNA Lentiviral Transduction Particles
alkylglycerone phosphate synthase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-526s1c1
Sequence:CCGGCCTCCTTCTATTGTGAATGAACTCGAGTTCATTCACAATAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172666.2-2424s1c1
Sequence:CCGGGCAGATAATCTAGCAAAGATTCTCGAGAATCTTTGCTAGATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-2001s1c1
Sequence:CCGGCCCAAGTAACATCTTTGGAAACTCGAGTTTCCAAAGATGTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-1578s1c1
Sequence:CCGGGCTGACTTATGTCATTGCATACTCGAGTATGCAATGACATAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172666.2-898s1c1
Sequence:CCGGGCTGGGATAACAGGACAAGATCTCGAGATCTTGTCCTGTTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172666.2-2282s21c1
Sequence:CCGGAGCACAAGGCTGCCCATTATCCTCGAGGATAATGGGCAGCCTTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172666.2-623s21c1
Sequence:CCGGGTCATTGTCTTCACGAGATATCTCGAGATATCTCGTGAAGACAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003659
VALIDATED
AGPS MISSION shRNA Bacterial Glycerol Stock
alkylglycerone phosphate synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_003659.1-457s1c1
Sequence:CCGGGCATCCTTAAATCCTAGTGATCTCGAGATCACTAGGATTTAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-610s1c1
Sequence:CCGGGAAGGAATGTTTGAGCGAATTCTCGAGAATTCGCTCAAACATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_003659.1-792s1c1
Sequence:CCGGCACTTCACAAATGAATCGAATCTCGAGATTCGATTCATTTGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-1315s1c1
Sequence:CCGGCCTCAGGTTTCCTCTATCTTTCTCGAGAAAGATAGAGGAAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-1816s1c1
Sequence:CCGGGCTGCTAGAGAAGAAATCCTTCTCGAGAAGGATTTCTTCTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003659.3-7135s21c1
Sequence:CCGGGCCTTCAGAATAACGAATATTCTCGAGAATATTCGTTATTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-1813s21c1
Sequence:CCGGGTGACCCACTGACCGTATTTGCTCGAGCAAATACGGTCAGTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-411s21c1
Sequence:CCGGGGCATGGGTTTACCAACATTTCTCGAGAAATGTTGGTAAACCCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-1034s21c1
Sequence:CCGGCGAGGACCTGGTGGTTCATATCTCGAGATATGAACCACCAGGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-580s21c1
Sequence:CCGGAGGCAGATGATCGAGTATTTACTCGAGTAAATACTCGATCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003659
VALIDATED
AGPS MISSION shRNA shRNA Plasmid DNA
alkylglycerone phosphate synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_003659.1-457s1c1
Sequence:CCGGGCATCCTTAAATCCTAGTGATCTCGAGATCACTAGGATTTAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-610s1c1
Sequence:CCGGGAAGGAATGTTTGAGCGAATTCTCGAGAATTCGCTCAAACATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_003659.1-792s1c1
Sequence:CCGGCACTTCACAAATGAATCGAATCTCGAGATTCGATTCATTTGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-1315s1c1
Sequence:CCGGCCTCAGGTTTCCTCTATCTTTCTCGAGAAAGATAGAGGAAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-1816s1c1
Sequence:CCGGGCTGCTAGAGAAGAAATCCTTCTCGAGAAGGATTTCTTCTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003659.3-7135s21c1
Sequence:CCGGGCCTTCAGAATAACGAATATTCTCGAGAATATTCGTTATTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-1813s21c1
Sequence:CCGGGTGACCCACTGACCGTATTTGCTCGAGCAAATACGGTCAGTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-411s21c1
Sequence:CCGGGGCATGGGTTTACCAACATTTCTCGAGAAATGTTGGTAAACCCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-1034s21c1
Sequence:CCGGCGAGGACCTGGTGGTTCATATCTCGAGATATGAACCACCAGGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-580s21c1
Sequence:CCGGAGGCAGATGATCGAGTATTTACTCGAGTAAATACTCGATCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003659
VALIDATED
AGPS MISSION shRNA Lentiviral Transduction Particles
alkylglycerone phosphate synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_003659.1-457s1c1
Sequence:CCGGGCATCCTTAAATCCTAGTGATCTCGAGATCACTAGGATTTAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-610s1c1
Sequence:CCGGGAAGGAATGTTTGAGCGAATTCTCGAGAATTCGCTCAAACATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_003659.1-792s1c1
Sequence:CCGGCACTTCACAAATGAATCGAATCTCGAGATTCGATTCATTTGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-1315s1c1
Sequence:CCGGCCTCAGGTTTCCTCTATCTTTCTCGAGAAAGATAGAGGAAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003659.1-1816s1c1
Sequence:CCGGGCTGCTAGAGAAGAAATCCTTCTCGAGAAGGATTTCTTCTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003659.3-7135s21c1
Sequence:CCGGGCCTTCAGAATAACGAATATTCTCGAGAATATTCGTTATTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-1813s21c1
Sequence:CCGGGTGACCCACTGACCGTATTTGCTCGAGCAAATACGGTCAGTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-411s21c1
Sequence:CCGGGGCATGGGTTTACCAACATTTCTCGAGAAATGTTGGTAAACCCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-1034s21c1
Sequence:CCGGCGAGGACCTGGTGGTTCATATCTCGAGATATGAACCACCAGGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003659.3-580s21c1
Sequence:CCGGAGGCAGATGATCGAGTATTTACTCGAGTAAATACTCGATCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks