EMAIL THIS PAGE TO A FRIEND

AGR2

anterior gradient 2

Synonyms: AG2 GOB-4 HAG-2 PDIA17 XAG-2
UniProtKB ID: O95994
Gene ID:
Mouse(23795) anterior gradient 2
Rat(298961) anterior gradient 2 homolog (Xenopus laevis)
Zebrafish(335616) anterior gradient homolog 2 (Xenopus laevis)
chicken(420596) anterior gradient homolog 2 (Xenopus laevis)
domestic cat(101084694) anterior gradient 2 homolog (Xenopus laevis)
cow(415112) anterior gradient homolog 2 (Xenopus laevis)
dog(482333) anterior gradient 2 homolog (Xenopus laevis)
naked mole-rat(101710020) anterior gradient 2 homolog (Xenopus laevis)
domestic guinea pig(100714759) anterior gradient 2 homolog (Xenopus laevis)
sheep(101105323) anterior gradient 2 homolog (Xenopus laevis)
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006408 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028241 MISSION® esiRNA esiRNA human AGR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006408 Rosetta Predictions human pricing
NM_001106725 Rosetta Predictions rat pricing
NM_011783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175980 predicted 343
2 SASI_Hs02_00341500 predicted 205
3 SASI_Hs01_00175982 predicted 220
4 SASI_Hs01_00175981 predicted 250
5 SASI_Hs01_00175984 predicted 485
6 SASI_Hs01_00175985 predicted 474
7 SASI_Hs02_00341501 predicted 467
8 SASI_Hs02_00341502 predicted 220
9 SASI_Hs01_00175986 predicted 432
10 SASI_Hs02_00341503 predicted 350
11 SASI_Hs01_00175983 predicted 378
12 SASI_Hs01_00175987 predicted 405
13 SASI_Hs01_00175988 predicted 112
14 SASI_Hs01_00175989 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221778 predicted 395
2 SASI_Rn02_00221779 predicted 527
3 SASI_Rn02_00221780 predicted 387
4 SASI_Rn02_00221781 predicted 635
5 SASI_Rn02_00221782 predicted 316
6 SASI_Rn02_00221783 predicted 461
7 SASI_Rn02_00221784 predicted 277
8 SASI_Rn02_00221785 predicted 519
9 SASI_Rn02_00221786 predicted 566
10 SASI_Rn02_00221787 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055513 predicted 214
2 SASI_Mm02_00321432 predicted 351
3 SASI_Mm01_00055515 predicted 362
4 SASI_Mm02_00321433 predicted 520
5 SASI_Mm01_00055514 predicted 458
6 SASI_Mm01_00055516 predicted 461
7 SASI_Mm01_00055518 predicted 489
8 SASI_Mm01_00055519 predicted 344
9 SASI_Mm01_00055521 predicted 216
10 SASI_Mm02_00321434 predicted 254
11 SASI_Mm01_00055517 predicted 521
12 SASI_Mm01_00055520 predicted 396
13 SASI_Mm01_00055522 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006408
AGR2 MISSION shRNA Bacterial Glycerol Stock
anterior gradient 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-530s21c1
Sequence:CCGGGACAAACACCTTTCTCCTGATCTCGAGATCAGGAGAAAGGTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006408.3-751s21c1
Sequence:CCGGCCTTGAGACTTGAAACCAGAACTCGAGTTCTGGTTTCAAGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-689s21c1
Sequence:CCGGCTCAAGTTGCTGAAGACTGAACTCGAGTTCAGTCTTCAGCAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-618s21c1
Sequence:CCGGGATATTCAAATCGTCTCTATGCTCGAGCATAGAGACGATTTGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-370s1c1
Sequence:CCGGGTCCTCCTCAATCTGGTTTATCTCGAGATAAACCAGATTGAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-559s1c1
Sequence:CCGGCTCAAGTTGCTGAAGACTGAACTCGAGTTCAGTCTTCAGCAACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006408.2-621s1c1
Sequence:CCGGCCTTGAGACTTGAAACCAGAACTCGAGTTCTGGTTTCAAGTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-252s1c1
Sequence:CCGGCAAGACAAGCAACAAACCCTTCTCGAGAAGGGTTTGTTGCTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-400s1c1
Sequence:CCGGGACAAACACCTTTCTCCTGATCTCGAGATCAGGAGAAAGGTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006408.2-260s1c1
Sequence:CCGGGCAACAAACCCTTGATGATTACTCGAGTAATCATCAAGGGTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006408
AGR2 MISSION shRNA shRNA Plasmid DNA
anterior gradient 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-530s21c1
Sequence:CCGGGACAAACACCTTTCTCCTGATCTCGAGATCAGGAGAAAGGTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006408.3-751s21c1
Sequence:CCGGCCTTGAGACTTGAAACCAGAACTCGAGTTCTGGTTTCAAGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-689s21c1
Sequence:CCGGCTCAAGTTGCTGAAGACTGAACTCGAGTTCAGTCTTCAGCAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-618s21c1
Sequence:CCGGGATATTCAAATCGTCTCTATGCTCGAGCATAGAGACGATTTGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-370s1c1
Sequence:CCGGGTCCTCCTCAATCTGGTTTATCTCGAGATAAACCAGATTGAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-559s1c1
Sequence:CCGGCTCAAGTTGCTGAAGACTGAACTCGAGTTCAGTCTTCAGCAACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006408.2-621s1c1
Sequence:CCGGCCTTGAGACTTGAAACCAGAACTCGAGTTCTGGTTTCAAGTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-252s1c1
Sequence:CCGGCAAGACAAGCAACAAACCCTTCTCGAGAAGGGTTTGTTGCTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-400s1c1
Sequence:CCGGGACAAACACCTTTCTCCTGATCTCGAGATCAGGAGAAAGGTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006408.2-260s1c1
Sequence:CCGGGCAACAAACCCTTGATGATTACTCGAGTAATCATCAAGGGTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006408
AGR2 MISSION shRNA Lentiviral Transduction Particles
anterior gradient 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-530s21c1
Sequence:CCGGGACAAACACCTTTCTCCTGATCTCGAGATCAGGAGAAAGGTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006408.3-751s21c1
Sequence:CCGGCCTTGAGACTTGAAACCAGAACTCGAGTTCTGGTTTCAAGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-689s21c1
Sequence:CCGGCTCAAGTTGCTGAAGACTGAACTCGAGTTCAGTCTTCAGCAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006408.3-618s21c1
Sequence:CCGGGATATTCAAATCGTCTCTATGCTCGAGCATAGAGACGATTTGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-370s1c1
Sequence:CCGGGTCCTCCTCAATCTGGTTTATCTCGAGATAAACCAGATTGAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-559s1c1
Sequence:CCGGCTCAAGTTGCTGAAGACTGAACTCGAGTTCAGTCTTCAGCAACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006408.2-621s1c1
Sequence:CCGGCCTTGAGACTTGAAACCAGAACTCGAGTTCTGGTTTCAAGTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-252s1c1
Sequence:CCGGCAAGACAAGCAACAAACCCTTCTCGAGAAGGGTTTGTTGCTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006408.2-400s1c1
Sequence:CCGGGACAAACACCTTTCTCCTGATCTCGAGATCAGGAGAAAGGTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006408.2-260s1c1
Sequence:CCGGGCAACAAACCCTTGATGATTACTCGAGTAATCATCAAGGGTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011783
AGR2 MISSION shRNA Bacterial Glycerol Stock
anterior gradient 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011783.1-630s1c1
Sequence:CCGGCTTGCAGATTACAGTACAGTTCTCGAGAACTGTACTGTAATCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-559s1c1
Sequence:CCGGGCTGCTAAAGACAGAATTGTACTCGAGTACAATTCTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-365s1c1
Sequence:CCGGGTTCTCCTCAACCTGGTCTATCTCGAGATAGACCAGGTTGAGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-368s1c1
Sequence:CCGGCTCCTCAACCTGGTCTATGAACTCGAGTTCATAGACCAGGTTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-295s1c1
Sequence:CCGGCCCACACAGTCAAGCCTTAAACTCGAGTTTAAGGCTTGACTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011783
AGR2 MISSION shRNA shRNA Plasmid DNA
anterior gradient 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011783.1-630s1c1
Sequence:CCGGCTTGCAGATTACAGTACAGTTCTCGAGAACTGTACTGTAATCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-559s1c1
Sequence:CCGGGCTGCTAAAGACAGAATTGTACTCGAGTACAATTCTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-365s1c1
Sequence:CCGGGTTCTCCTCAACCTGGTCTATCTCGAGATAGACCAGGTTGAGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-368s1c1
Sequence:CCGGCTCCTCAACCTGGTCTATGAACTCGAGTTCATAGACCAGGTTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-295s1c1
Sequence:CCGGCCCACACAGTCAAGCCTTAAACTCGAGTTTAAGGCTTGACTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011783
AGR2 MISSION shRNA Lentiviral Transduction Particles
anterior gradient 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011783.1-630s1c1
Sequence:CCGGCTTGCAGATTACAGTACAGTTCTCGAGAACTGTACTGTAATCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-559s1c1
Sequence:CCGGGCTGCTAAAGACAGAATTGTACTCGAGTACAATTCTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-365s1c1
Sequence:CCGGGTTCTCCTCAACCTGGTCTATCTCGAGATAGACCAGGTTGAGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-368s1c1
Sequence:CCGGCTCCTCAACCTGGTCTATGAACTCGAGTTCATAGACCAGGTTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011783.1-295s1c1
Sequence:CCGGCCCACACAGTCAAGCCTTAAACTCGAGTTTAAGGCTTGACTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks