EMAIL THIS PAGE TO A FRIEND

AGR3

anterior gradient 3

Synonyms: AG3 BCMP11 HAG3 PDIA18 hAG-3
UniProtKB ID: Q8TD06, A4D120
Gene ID:
Mouse(403205) anterior gradient 3
Rat(298959) anterior gradient 3
sheep(101105742) anterior gradient 3 homolog (Xenopus laevis)
chicken(420597) anterior gradient homolog 3 (Xenopus laevis)
cow(618371) anterior gradient 3 homolog (Xenopus laevis)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031911 MISSION® esiRNA esiRNA human AGR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176813 Rosetta Predictions human pricing
NM_001106724 Rosetta Predictions rat pricing
NM_207531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094948 predicted 487
2 SASI_Hs01_00094949 predicted 354
3 SASI_Hs01_00094950 predicted 471
4 SASI_Hs01_00094951 predicted 439
5 SASI_Hs02_00369232 predicted 341
6 SASI_Hs01_00094956 predicted 401
7 SASI_Hs02_00369233 predicted 464
8 SASI_Hs01_00094957 predicted 475
9 SASI_Hs02_00369234 predicted 236
10 SASI_Hs02_00369235 predicted 273
11 SASI_Hs01_00094952 predicted 350
12 SASI_Hs01_00094953 predicted 381
13 SASI_Hs01_00094954 predicted 340
14 SASI_Hs01_00094955 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221768 predicted 538
2 SASI_Rn02_00221769 predicted 533
3 SASI_Rn02_00221770 predicted 668
4 SASI_Rn02_00221771 predicted 337
5 SASI_Rn02_00221772 predicted 699
6 SASI_Rn02_00221773 predicted 655
7 SASI_Rn02_00221774 predicted 518
8 SASI_Rn02_00221775 predicted 616
9 SASI_Rn02_00221776 predicted 536
10 SASI_Rn02_00221777 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040682 predicted 457
2 SASI_Mm01_00040683 predicted 430
3 SASI_Mm01_00040684 predicted 267
4 SASI_Mm02_00352074 predicted 420
5 SASI_Mm01_00040685 predicted 443
6 SASI_Mm01_00040686 predicted 370
7 SASI_Mm01_00040687 predicted 465
8 SASI_Mm01_00040688 predicted 266
9 SASI_Mm02_00352075 predicted 235
10 SASI_Mm01_00040689 predicted 344
11 SASI_Mm01_00040690 predicted 433
12 SASI_Mm01_00040691 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176813
AGR3 MISSION shRNA Bacterial Glycerol Stock
anterior gradient 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176813.3-591s1c1
Sequence:CCGGGCCTTCACTTCAAAGAAGTCACTCGAGTGACTTCTTTGAAGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-552s1c1
Sequence:CCGGGACTTATTCAGTCAGAGCTATCTCGAGATAGCTCTGACTGAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-278s1c1
Sequence:CCGGGAGGATTGTCAATACTCTCAACTCGAGTTGAGAGTATTGACAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176813.3-191s1c1
Sequence:CCGGGATGACATCACTTGGGTACAACTCGAGTTGTACCCAAGTGATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-430s1c1
Sequence:CCGGCATGTTTGTAGACCCTTCTTTCTCGAGAAAGAAGGGTCTACAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176813.3-592s1c1
Sequence:CCGGCCTTCACTTCAAAGAAGTCAACTCGAGTTGACTTCTTTGAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-127s21c1
Sequence:CCGGCAACCTTGCCATTGCAATAAACTCGAGTTTATTGCAATGGCAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-249s21c1
Sequence:CCGGAGAAGCCATTAATGGTTATTCCTCGAGGAATAACCATTAATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-193s21c1
Sequence:CCGGTGACATCACTTGGGTACAAACCTCGAGGTTTGTACCCAAGTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176813
AGR3 MISSION shRNA shRNA Plasmid DNA
anterior gradient 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176813.3-591s1c1
Sequence:CCGGGCCTTCACTTCAAAGAAGTCACTCGAGTGACTTCTTTGAAGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-552s1c1
Sequence:CCGGGACTTATTCAGTCAGAGCTATCTCGAGATAGCTCTGACTGAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-278s1c1
Sequence:CCGGGAGGATTGTCAATACTCTCAACTCGAGTTGAGAGTATTGACAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176813.3-191s1c1
Sequence:CCGGGATGACATCACTTGGGTACAACTCGAGTTGTACCCAAGTGATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-430s1c1
Sequence:CCGGCATGTTTGTAGACCCTTCTTTCTCGAGAAAGAAGGGTCTACAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176813.3-592s1c1
Sequence:CCGGCCTTCACTTCAAAGAAGTCAACTCGAGTTGACTTCTTTGAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-127s21c1
Sequence:CCGGCAACCTTGCCATTGCAATAAACTCGAGTTTATTGCAATGGCAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-249s21c1
Sequence:CCGGAGAAGCCATTAATGGTTATTCCTCGAGGAATAACCATTAATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-193s21c1
Sequence:CCGGTGACATCACTTGGGTACAAACCTCGAGGTTTGTACCCAAGTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176813
AGR3 MISSION shRNA Lentiviral Transduction Particles
anterior gradient 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176813.3-591s1c1
Sequence:CCGGGCCTTCACTTCAAAGAAGTCACTCGAGTGACTTCTTTGAAGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-552s1c1
Sequence:CCGGGACTTATTCAGTCAGAGCTATCTCGAGATAGCTCTGACTGAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-278s1c1
Sequence:CCGGGAGGATTGTCAATACTCTCAACTCGAGTTGAGAGTATTGACAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176813.3-191s1c1
Sequence:CCGGGATGACATCACTTGGGTACAACTCGAGTTGTACCCAAGTGATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176813.3-430s1c1
Sequence:CCGGCATGTTTGTAGACCCTTCTTTCTCGAGAAAGAAGGGTCTACAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176813.3-592s1c1
Sequence:CCGGCCTTCACTTCAAAGAAGTCAACTCGAGTTGACTTCTTTGAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-127s21c1
Sequence:CCGGCAACCTTGCCATTGCAATAAACTCGAGTTTATTGCAATGGCAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-249s21c1
Sequence:CCGGAGAAGCCATTAATGGTTATTCCTCGAGGAATAACCATTAATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176813.3-193s21c1
Sequence:CCGGTGACATCACTTGGGTACAAACCTCGAGGTTTGTACCCAAGTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207531
AGR3 MISSION shRNA Bacterial Glycerol Stock
anterior gradient 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-109s1c1
Sequence:CCGGGTTTCTTCAAACCTTGCCATTCTCGAGAATGGCAAGGTTTGAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-437s1c1
Sequence:CCGGCTTTGACTGTCAGGGCTGATACTCGAGTATCAGCCCTGACAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-420s1c1
Sequence:CCGGCATGTTTGTTGACCCTTCTTTCTCGAGAAAGAAGGGTCAACAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-409s1c1
Sequence:CCGGGTGCCCAGGATCATGTTTGTTCTCGAGAACAAACATGATCCTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207531
AGR3 MISSION shRNA shRNA Plasmid DNA
anterior gradient 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-109s1c1
Sequence:CCGGGTTTCTTCAAACCTTGCCATTCTCGAGAATGGCAAGGTTTGAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-437s1c1
Sequence:CCGGCTTTGACTGTCAGGGCTGATACTCGAGTATCAGCCCTGACAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-420s1c1
Sequence:CCGGCATGTTTGTTGACCCTTCTTTCTCGAGAAAGAAGGGTCAACAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-409s1c1
Sequence:CCGGGTGCCCAGGATCATGTTTGTTCTCGAGAACAAACATGATCCTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207531
AGR3 MISSION shRNA Lentiviral Transduction Particles
anterior gradient 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-109s1c1
Sequence:CCGGGTTTCTTCAAACCTTGCCATTCTCGAGAATGGCAAGGTTTGAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-437s1c1
Sequence:CCGGCTTTGACTGTCAGGGCTGATACTCGAGTATCAGCCCTGACAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-420s1c1
Sequence:CCGGCATGTTTGTTGACCCTTCTTTCTCGAGAAAGAAGGGTCAACAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207531.1-409s1c1
Sequence:CCGGGTGCCCAGGATCATGTTTGTTCTCGAGAACAAACATGATCCTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks