EMAIL THIS PAGE TO A FRIEND

AGRN

agrin

72 Gene Product Result for
Gene ID:
Human(375790) Summary: This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. [provided by RefSeq, Aug 2011]
Mouse(11603) agrin
Rat(25592) agrin
dog(479574) agrin
cow(525795) agrin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0881 Rat Agrn / Agrin ELISA Kit rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_372195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372195 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139461 MISSION® esiRNA esiRNA human AGRN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198576 Rosetta Predictions human pricing
NM_175754 Rosetta Predictions rat pricing
NM_021604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051229 predicted 3577
2 SASI_Hs01_00051231 predicted 5870
3 SASI_Hs01_00051232 predicted 2730
4 SASI_Hs01_00051233 predicted 4794
5 SASI_Hs01_00051234 predicted 5655
6 SASI_Hs01_00051235 predicted 497
7 SASI_Hs01_00051236 predicted 5706
8 SASI_Hs01_00051238 predicted 3649
9 SASI_Hs02_00372208 predicted 388
10 SASI_Hs02_00372209 predicted 1597
11 SASI_Hs01_00051230 predicted 5900
12 SASI_Hs01_00051237 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061463 predicted 647
2 SASI_Rn02_00269508 predicted 3625
3 SASI_Rn01_00061464 predicted 5046
4 SASI_Rn01_00061465 predicted 4413
5 SASI_Rn01_00061466 predicted 2461
6 SASI_Rn01_00061467 predicted 1969
7 SASI_Rn02_00269509 predicted 3478
8 SASI_Rn01_00061468 predicted 1601
9 SASI_Rn01_00061469 predicted 302
10 SASI_Rn01_00061471 predicted 3017
11 SASI_Rn01_00061462 predicted 646
12 SASI_Rn01_00061470 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101836 predicted 847
2 SASI_Mm01_00101837 predicted 3241
3 SASI_Mm01_00101838 predicted 499
4 SASI_Mm01_00101839 predicted 3969
5 SASI_Mm01_00101840 predicted 306
6 SASI_Mm01_00101841 predicted 5244
7 SASI_Mm01_00101842 predicted 467
8 SASI_Mm02_00326360 predicted 3891
9 SASI_Mm02_00326361 predicted 3029
10 SASI_Mm01_00101844 predicted 4667
11 SASI_Mm01_00101843 predicted 3091
12 SASI_Mm01_00101845 predicted 1744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198576
AGRN MISSION shRNA Bacterial Glycerol Stock
agrin
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000426201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-1126s21c1
Sequence:CCGGACGACGGAGTCACCTACGAAACTCGAGTTTCGTAGGTGACTCCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198576.2-6599s21c1
Sequence:CCGGCCATTTGAGCTGCTCCTTCCTCTCGAGAGGAAGGAGCAGCTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-3773s21c1
Sequence:CCGGGCAGGAGCACGTGCGATTTATCTCGAGATAAATCGCACGTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-1349s21c1
Sequence:CCGGGCGCACGTATGACAGTGATTGCTCGAGCAATCACTGTCATACGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198576
AGRN MISSION shRNA shRNA Plasmid DNA
agrin
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000426201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-1126s21c1
Sequence:CCGGACGACGGAGTCACCTACGAAACTCGAGTTTCGTAGGTGACTCCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198576.2-6599s21c1
Sequence:CCGGCCATTTGAGCTGCTCCTTCCTCTCGAGAGGAAGGAGCAGCTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-3773s21c1
Sequence:CCGGGCAGGAGCACGTGCGATTTATCTCGAGATAAATCGCACGTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-1349s21c1
Sequence:CCGGGCGCACGTATGACAGTGATTGCTCGAGCAATCACTGTCATACGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198576
AGRN MISSION shRNA Lentiviral Transduction Particles
agrin
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000426201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-1126s21c1
Sequence:CCGGACGACGGAGTCACCTACGAAACTCGAGTTTCGTAGGTGACTCCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198576.2-6599s21c1
Sequence:CCGGCCATTTGAGCTGCTCCTTCCTCTCGAGAGGAAGGAGCAGCTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-3773s21c1
Sequence:CCGGGCAGGAGCACGTGCGATTTATCTCGAGATAAATCGCACGTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198576.2-1349s21c1
Sequence:CCGGGCGCACGTATGACAGTGATTGCTCGAGCAATCACTGTCATACGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021604
VALIDATED
AGRN MISSION shRNA Bacterial Glycerol Stock
agrin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-506s21c1
Sequence:CCGGCATGTCAGACCTGAATCATATCTCGAGATATGATTCAGGTCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-169s21c1
Sequence:CCGGGCTCAGATGCTTCCACCTATACTCGAGTATAGGTGGAAGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-5960s21c1
Sequence:CCGGGCACTGTTTGTGTGTTATTAACTCGAGTTAATAACACACAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-1484s21c1
Sequence:CCGGCTGTCAGCAGCAGGTACAAATCTCGAGATTTGTACCTGCTGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021604.2-3432s21c1
Sequence:CCGGCCAACCACTACCGCCAGTATTCTCGAGAATACTGGCGGTAGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-5960s1c1
Sequence:CCGGGCACTGTTTGTGTGTTATTAACTCGAGTTAATAACACACAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-730s1c1
Sequence:CCGGCCTGCCAGTTTAACTCTGTATCTCGAGATACAGAGTTAAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-1693s1c1
Sequence:CCGGGCTCAGATGGAGTCACCTATACTCGAGTATAGGTGACTCCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-169s1c1
Sequence:CCGGGCTCAGATGCTTCCACCTATACTCGAGTATAGGTGGAAGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-4626s1c1
Sequence:CCGGGCTGCAATCATCAGGAGCAAACTCGAGTTTGCTCCTGATGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021604
VALIDATED
AGRN MISSION shRNA shRNA Plasmid DNA
agrin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-506s21c1
Sequence:CCGGCATGTCAGACCTGAATCATATCTCGAGATATGATTCAGGTCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-169s21c1
Sequence:CCGGGCTCAGATGCTTCCACCTATACTCGAGTATAGGTGGAAGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-5960s21c1
Sequence:CCGGGCACTGTTTGTGTGTTATTAACTCGAGTTAATAACACACAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-1484s21c1
Sequence:CCGGCTGTCAGCAGCAGGTACAAATCTCGAGATTTGTACCTGCTGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021604.2-3432s21c1
Sequence:CCGGCCAACCACTACCGCCAGTATTCTCGAGAATACTGGCGGTAGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-5960s1c1
Sequence:CCGGGCACTGTTTGTGTGTTATTAACTCGAGTTAATAACACACAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-730s1c1
Sequence:CCGGCCTGCCAGTTTAACTCTGTATCTCGAGATACAGAGTTAAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-1693s1c1
Sequence:CCGGGCTCAGATGGAGTCACCTATACTCGAGTATAGGTGACTCCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-169s1c1
Sequence:CCGGGCTCAGATGCTTCCACCTATACTCGAGTATAGGTGGAAGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-4626s1c1
Sequence:CCGGGCTGCAATCATCAGGAGCAAACTCGAGTTTGCTCCTGATGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021604
VALIDATED
AGRN MISSION shRNA Lentiviral Transduction Particles
agrin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-506s21c1
Sequence:CCGGCATGTCAGACCTGAATCATATCTCGAGATATGATTCAGGTCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-169s21c1
Sequence:CCGGGCTCAGATGCTTCCACCTATACTCGAGTATAGGTGGAAGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-5960s21c1
Sequence:CCGGGCACTGTTTGTGTGTTATTAACTCGAGTTAATAACACACAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021604.2-1484s21c1
Sequence:CCGGCTGTCAGCAGCAGGTACAAATCTCGAGATTTGTACCTGCTGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021604.2-3432s21c1
Sequence:CCGGCCAACCACTACCGCCAGTATTCTCGAGAATACTGGCGGTAGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-5960s1c1
Sequence:CCGGGCACTGTTTGTGTGTTATTAACTCGAGTTAATAACACACAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-730s1c1
Sequence:CCGGCCTGCCAGTTTAACTCTGTATCTCGAGATACAGAGTTAAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-1693s1c1
Sequence:CCGGGCTCAGATGGAGTCACCTATACTCGAGTATAGGTGACTCCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-169s1c1
Sequence:CCGGGCTCAGATGCTTCCACCTATACTCGAGTATAGGTGGAAGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021604.2-4626s1c1
Sequence:CCGGGCTGCAATCATCAGGAGCAAACTCGAGTTTGCTCCTGATGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372195
VALIDATED
AGRN MISSION shRNA Bacterial Glycerol Stock
agrin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-3604s1c1
Sequence:CCGGGCCATTGTGGATGTGCACTTTCTCGAGAAAGTGCACATCCACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-448s1c1
Sequence:CCGGGAGTTCTGTGTGGAAGATAAACTCGAGTTTATCTTCCACACAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-2565s1c1
Sequence:CCGGGCGGGATGACTGTGAGCAGATCTCGAGATCTGCTCACAGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-5028s1c1
Sequence:CCGGCCTGCTCTACAACGGGCAGAACTCGAGTTCTGCCCGTTGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-914s1c1
Sequence:CCGGGCCAGGAGAATGTCTTCAAGACTCGAGTCTTGAAGACATTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372195
VALIDATED
AGRN MISSION shRNA shRNA Plasmid DNA
agrin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-3604s1c1
Sequence:CCGGGCCATTGTGGATGTGCACTTTCTCGAGAAAGTGCACATCCACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-448s1c1
Sequence:CCGGGAGTTCTGTGTGGAAGATAAACTCGAGTTTATCTTCCACACAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-2565s1c1
Sequence:CCGGGCGGGATGACTGTGAGCAGATCTCGAGATCTGCTCACAGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-5028s1c1
Sequence:CCGGCCTGCTCTACAACGGGCAGAACTCGAGTTCTGCCCGTTGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-914s1c1
Sequence:CCGGGCCAGGAGAATGTCTTCAAGACTCGAGTCTTGAAGACATTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372195
VALIDATED
AGRN MISSION shRNA Lentiviral Transduction Particles
agrin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-3604s1c1
Sequence:CCGGGCCATTGTGGATGTGCACTTTCTCGAGAAAGTGCACATCCACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-448s1c1
Sequence:CCGGGAGTTCTGTGTGGAAGATAAACTCGAGTTTATCTTCCACACAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-2565s1c1
Sequence:CCGGGCGGGATGACTGTGAGCAGATCTCGAGATCTGCTCACAGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-5028s1c1
Sequence:CCGGCCTGCTCTACAACGGGCAGAACTCGAGTTCTGCCCGTTGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_372195.2-914s1c1
Sequence:CCGGGCCAGGAGAATGTCTTCAAGACTCGAGTCTTGAAGACATTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks