EMAIL THIS PAGE TO A FRIEND

AGRP

agouti related protein homolog (mouse)

69 Gene Product Result for
Synonyms: AGRT ART ASIP2
UniProtKB ID: O00253, O15459, Q2TBD9
Gene ID:
Human(181) Summary: This gene encodes an antagonist of the melanocortin-3 and melanocortin-4 receptor. It appears to regulate hypothalamic control of feeding behavior via melanocortin receptor and/or intracellular calcium regulation, and thus plays a role in weight homeostasis. Mutations in this gene have been associated with late on-set obesity. [provided by RefSeq, Dec 2009]
Mouse(11604) agouti related protein
Rat(25582) agouti related protein homolog (mouse)
sheep(443269) agouti related protein homolog (mouse)
domestic guinea pig(100732852) agouti related protein homolog (mouse)
naked mole-rat(101711496) agouti related protein homolog (mouse)
Zebrafish(100149042) agouti related protein homolog
chicken(427535) agouti related protein homolog (mouse)
cow(280987) agouti related protein homolog (mouse)
cow(782203) agouti related protein homolog (mouse)-like
domestic cat(101100855) agouti related protein homolog (mouse)
dog(611198) agouti related protein homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001138 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001138 Rosetta Predictions human pricing
NM_007316 Rosetta Predictions human pricing
XM_001075738 Rosetta Predictions rat pricing
XM_574228 Rosetta Predictions rat pricing
NM_007427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207713 predicted 542
2 SASI_Hs01_00207714 predicted 499
3 SASI_Hs01_00207715 predicted 472
4 SASI_Hs01_00207716 predicted 504
5 SASI_Hs01_00207718 predicted 302
6 SASI_Hs01_00207719 predicted 493
7 SASI_Hs01_00207720 predicted 305
8 SASI_Hs01_00207721 predicted 503
9 SASI_Hs01_00207717 predicted 308
10 SASI_Hs01_00207722 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068157 predicted 245
2 SASI_Hs01_00068158 predicted 199
3 SASI_Hs01_00068159 predicted 207
4 SASI_Hs01_00068160 predicted 200
5 SASI_Hs01_00068161 predicted 201
6 SASI_Hs01_00068162 predicted 316
7 SASI_Hs01_00068163 predicted 293
8 SASI_Hs01_00068164 predicted 427
9 SASI_Hs01_00068165 predicted 173
10 SASI_Hs01_00068166 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350868 predicted 361
2 SASI_Rn02_00350869 predicted 405
3 SASI_Rn02_00350870 predicted 277
4 SASI_Rn02_00350871 predicted 327
5 SASI_Rn02_00350872 predicted 329
6 SASI_Rn02_00350873 predicted 321
7 SASI_Rn02_00350874 predicted 205
8 SASI_Rn02_00350875 predicted 328
9 SASI_Rn02_00350876 predicted 323
10 SASI_Rn02_00350877 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401624 predicted 367
2 SASI_Rn02_00401625 predicted 404
3 SASI_Rn02_00401626 predicted 281
4 SASI_Rn02_00401627 predicted 335
5 SASI_Rn02_00401628 predicted 330
6 SASI_Rn02_00401629 predicted 321
7 SASI_Rn02_00401630 predicted 204
8 SASI_Rn02_00401631 predicted 332
9 SASI_Rn02_00401632 predicted 317
10 SASI_Rn02_00401633 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157047 predicted 203
2 SASI_Mm01_00157048 predicted 336
3 SASI_Mm01_00157049 predicted 336
4 SASI_Mm01_00157050 predicted 217
5 SASI_Mm01_00157051 predicted 329
6 SASI_Mm01_00157052 predicted 297
7 SASI_Mm01_00157053 predicted 392
8 SASI_Mm01_00157054 predicted 379
9 SASI_Mm01_00157055 predicted 260
10 SASI_Mm01_00157056 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007427
AGRP MISSION shRNA Bacterial Glycerol Stock
agouti related protein homolog (mouse)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-139s1c1
Sequence:CCGGCTGAATGGCCTCAAGAAGACACTCGAGTGTCTTCTTGAGGCCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-123s1c1
Sequence:CCGGGTTCCCAGGTCTAAGTCTGAACTCGAGTTCAGACTTAGACCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-141s1c1
Sequence:CCGGGAATGGCCTCAAGAAGACAACCTCGAGGTTGTCTTCTTGAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-173s1c1
Sequence:CCGGCAGAAGAAGTTCTGCTGCAGACTCGAGTCTGCAGCAGAACTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007427
AGRP MISSION shRNA shRNA Plasmid DNA
agouti related protein homolog (mouse)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-139s1c1
Sequence:CCGGCTGAATGGCCTCAAGAAGACACTCGAGTGTCTTCTTGAGGCCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-123s1c1
Sequence:CCGGGTTCCCAGGTCTAAGTCTGAACTCGAGTTCAGACTTAGACCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-141s1c1
Sequence:CCGGGAATGGCCTCAAGAAGACAACCTCGAGGTTGTCTTCTTGAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-173s1c1
Sequence:CCGGCAGAAGAAGTTCTGCTGCAGACTCGAGTCTGCAGCAGAACTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007427
AGRP MISSION shRNA Lentiviral Transduction Particles
agouti related protein homolog (mouse)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-139s1c1
Sequence:CCGGCTGAATGGCCTCAAGAAGACACTCGAGTGTCTTCTTGAGGCCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-123s1c1
Sequence:CCGGGTTCCCAGGTCTAAGTCTGAACTCGAGTTCAGACTTAGACCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-141s1c1
Sequence:CCGGGAATGGCCTCAAGAAGACAACCTCGAGGTTGTCTTCTTGAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007427.1-173s1c1
Sequence:CCGGCAGAAGAAGTTCTGCTGCAGACTCGAGTCTGCAGCAGAACTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001138
AGRP MISSION shRNA Bacterial Glycerol Stock
agouti related protein homolog (mouse)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-448s1c1
Sequence:CCGGCCACTGAAGAAGACAACTGCACTCGAGTGCAGTTGTCTTCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-618s1c1
Sequence:CCGGCACGTGCTACTGCCGCTTCTTCTCGAGAAGAAGCGGCAGTAGCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-629s1c1
Sequence:CCGGGCCGCTTCTTCAATGCCTTCTCTCGAGAGAAGGCATTGAAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-460s1c1
Sequence:CCGGACAACTGCAGAACAGGCAGAACTCGAGTTCTGCCTGTTCTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-557s1c1
Sequence:CCGGGCTGCGTAAGGCTGCATGAGTCTCGAGACTCATGCAGCCTTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-662s21c1
Sequence:CCGGAGCTGGGTACTGCCATGAATCCTCGAGGATTCATGGCAGTACCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-596s21c1
Sequence:CCGGTGCCTTGCTGTGACCCATGTGCTCGAGCACATGGGTCACAGCAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-637s21c1
Sequence:CCGGTTCAATGCCTTCTGCTACTGCCTCGAGGCAGTAGCAGAAGGCATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-471s21c1
Sequence:CCGGACAGGCAGAAGAGGATCTGTTCTCGAGAACAGATCCTCTTCTGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001138
AGRP MISSION shRNA shRNA Plasmid DNA
agouti related protein homolog (mouse)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-448s1c1
Sequence:CCGGCCACTGAAGAAGACAACTGCACTCGAGTGCAGTTGTCTTCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-618s1c1
Sequence:CCGGCACGTGCTACTGCCGCTTCTTCTCGAGAAGAAGCGGCAGTAGCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-629s1c1
Sequence:CCGGGCCGCTTCTTCAATGCCTTCTCTCGAGAGAAGGCATTGAAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-460s1c1
Sequence:CCGGACAACTGCAGAACAGGCAGAACTCGAGTTCTGCCTGTTCTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-557s1c1
Sequence:CCGGGCTGCGTAAGGCTGCATGAGTCTCGAGACTCATGCAGCCTTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-662s21c1
Sequence:CCGGAGCTGGGTACTGCCATGAATCCTCGAGGATTCATGGCAGTACCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-596s21c1
Sequence:CCGGTGCCTTGCTGTGACCCATGTGCTCGAGCACATGGGTCACAGCAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-637s21c1
Sequence:CCGGTTCAATGCCTTCTGCTACTGCCTCGAGGCAGTAGCAGAAGGCATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-471s21c1
Sequence:CCGGACAGGCAGAAGAGGATCTGTTCTCGAGAACAGATCCTCTTCTGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001138
AGRP MISSION shRNA Lentiviral Transduction Particles
agouti related protein homolog (mouse)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-448s1c1
Sequence:CCGGCCACTGAAGAAGACAACTGCACTCGAGTGCAGTTGTCTTCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-618s1c1
Sequence:CCGGCACGTGCTACTGCCGCTTCTTCTCGAGAAGAAGCGGCAGTAGCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-629s1c1
Sequence:CCGGGCCGCTTCTTCAATGCCTTCTCTCGAGAGAAGGCATTGAAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-460s1c1
Sequence:CCGGACAACTGCAGAACAGGCAGAACTCGAGTTCTGCCTGTTCTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001138.1-557s1c1
Sequence:CCGGGCTGCGTAAGGCTGCATGAGTCTCGAGACTCATGCAGCCTTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-662s21c1
Sequence:CCGGAGCTGGGTACTGCCATGAATCCTCGAGGATTCATGGCAGTACCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-596s21c1
Sequence:CCGGTGCCTTGCTGTGACCCATGTGCTCGAGCACATGGGTCACAGCAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-637s21c1
Sequence:CCGGTTCAATGCCTTCTGCTACTGCCTCGAGGCAGTAGCAGAAGGCATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001138.1-471s21c1
Sequence:CCGGACAGGCAGAAGAGGATCTGTTCTCGAGAACAGATCCTCTTCTGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks