EMAIL THIS PAGE TO A FRIEND

AGTPBP1

ATP/GTP binding protein 1

123 Gene Product Result for
Synonyms: CCP1 NNA1
Gene ID:
Human(23287) Summary: NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
Mouse(67269) ATP/GTP binding protein 1
Rat(290986) ATP/GTP binding protein 1
Zebrafish(554164) ATP/GTP binding protein 1
cow(534958) ATP/GTP binding protein 1
Horse(100061665) ATP/GTP binding protein 1
domestic cat(101087359) ATP/GTP binding protein 1
chicken(427460) ATP/GTP binding protein 1
dog(484146) ATP/GTP binding protein 1
sheep(101115757) ATP/GTP binding protein 1
domestic guinea pig(100726862) ATP/GTP binding protein 1
naked mole-rat(101722036) ATP/GTP binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015239 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015239 Rosetta Predictions human pricing
NM_001106100 Rosetta Predictions rat pricing
NM_001048008 Rosetta Predictions mouse pricing
NM_023328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347371 predicted 1642
2 SASI_Hs01_00198369 predicted 3183
3 SASI_Hs02_00347372 predicted 452
4 SASI_Hs01_00198370 predicted 1390
5 SASI_Hs02_00347373 predicted 2191
6 SASI_Hs01_00198371 predicted 2997
7 SASI_Hs01_00198372 predicted 1988
8 SASI_Hs02_00347374 predicted 3316
9 SASI_Hs01_00198375 predicted 2498
10 SASI_Hs02_00347375 predicted 384
11 SASI_Hs01_00198373 predicted 1266
12 SASI_Hs01_00198374 predicted 726
13 SASI_Hs01_00198376 predicted 2008
14 SASI_Hs01_00198377 predicted 1087
15 SASI_Hs01_00198378 predicted 3138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215622 predicted 980
2 SASI_Rn02_00215623 predicted 1630
3 SASI_Rn02_00215624 predicted 1551
4 SASI_Rn02_00215625 predicted 2635
5 SASI_Rn02_00215626 predicted 1199
6 SASI_Rn02_00215627 predicted 2490
7 SASI_Rn02_00215628 predicted 2780
8 SASI_Rn02_00215629 predicted 1077
9 SASI_Rn02_00215630 predicted 3600
10 SASI_Rn02_00215631 predicted 2376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291951 predicted 776
2 SASI_Mm02_00291952 predicted 1527
3 SASI_Mm02_00291953 predicted 2143
4 SASI_Mm02_00291954 predicted 1842
5 SASI_Mm02_00291955 predicted 725
6 SASI_Mm02_00291956 predicted 372
7 SASI_Mm02_00291957 predicted 292
8 SASI_Mm02_00291958 predicted 467
9 SASI_Mm02_00291959 predicted 1986
10 SASI_Mm02_00291960 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054470 predicted 776
2 SASI_Mm01_00054471 predicted 1525
3 SASI_Mm01_00054472 predicted 2144
4 SASI_Mm02_00327062 predicted 1843
5 SASI_Mm01_00054474 predicted 725
6 SASI_Mm02_00327063 predicted 363
7 SASI_Mm02_00327064 predicted 297
8 SASI_Mm02_00327065 predicted 463
9 SASI_Mm02_00327066 predicted 1988
10 SASI_Mm01_00054479 predicted 571
11 SASI_Mm01_00054473 predicted 2604
12 SASI_Mm01_00054475 predicted 2012
13 SASI_Mm01_00054476 predicted 2793
14 SASI_Mm01_00054477 predicted 3421
15 SASI_Mm01_00054478 predicted 2666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023328
VALIDATED
AGTPBP1 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-1509s1c1
Sequence:CCGGGCGTAAAGAAAGGAGTGGTAACTCGAGTTACCACTCCTTTCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-1952s1c1
Sequence:CCGGCCAGACCTCTATATTGAGATTCTCGAGAATCTCAATATAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-881s1c1
Sequence:CCGGCGGCATAGAAACATGCTCATTCTCGAGAATGAGCATGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-401s1c1
Sequence:CCGGGCGAGTTTCTTAGTTGCCAAACTCGAGTTTGGCAACTAAGAAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-3245s1c1
Sequence:CCGGCCTAAGATACTGAGCCACATTCTCGAGAATGTGGCTCAGTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-1985s21c1
Sequence:CCGGCCAGACCTCTATATTGAGATTCTCGAGAATCTCAATATAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023328.2-914s21c1
Sequence:CCGGCGGCATAGAAACATGCTCATTCTCGAGAATGAGCATGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-892s21c1
Sequence:CCGGAGATTGGCACCGGCATGATAACTCGAGTTATCATGCCGGTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023328.2-4100s21c1
Sequence:CCGGTAAATTCAGTGTGTCCGAATACTCGAGTATTCGGACACACTGAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-434s21c1
Sequence:CCGGGCGAGTTTCTTAGTTGCCAAACTCGAGTTTGGCAACTAAGAAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023328
VALIDATED
AGTPBP1 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-1509s1c1
Sequence:CCGGGCGTAAAGAAAGGAGTGGTAACTCGAGTTACCACTCCTTTCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-1952s1c1
Sequence:CCGGCCAGACCTCTATATTGAGATTCTCGAGAATCTCAATATAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-881s1c1
Sequence:CCGGCGGCATAGAAACATGCTCATTCTCGAGAATGAGCATGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-401s1c1
Sequence:CCGGGCGAGTTTCTTAGTTGCCAAACTCGAGTTTGGCAACTAAGAAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-3245s1c1
Sequence:CCGGCCTAAGATACTGAGCCACATTCTCGAGAATGTGGCTCAGTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-1985s21c1
Sequence:CCGGCCAGACCTCTATATTGAGATTCTCGAGAATCTCAATATAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023328.2-914s21c1
Sequence:CCGGCGGCATAGAAACATGCTCATTCTCGAGAATGAGCATGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-892s21c1
Sequence:CCGGAGATTGGCACCGGCATGATAACTCGAGTTATCATGCCGGTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023328.2-4100s21c1
Sequence:CCGGTAAATTCAGTGTGTCCGAATACTCGAGTATTCGGACACACTGAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-434s21c1
Sequence:CCGGGCGAGTTTCTTAGTTGCCAAACTCGAGTTTGGCAACTAAGAAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023328
VALIDATED
AGTPBP1 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-1509s1c1
Sequence:CCGGGCGTAAAGAAAGGAGTGGTAACTCGAGTTACCACTCCTTTCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-1952s1c1
Sequence:CCGGCCAGACCTCTATATTGAGATTCTCGAGAATCTCAATATAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-881s1c1
Sequence:CCGGCGGCATAGAAACATGCTCATTCTCGAGAATGAGCATGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-401s1c1
Sequence:CCGGGCGAGTTTCTTAGTTGCCAAACTCGAGTTTGGCAACTAAGAAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023328.1-3245s1c1
Sequence:CCGGCCTAAGATACTGAGCCACATTCTCGAGAATGTGGCTCAGTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-1985s21c1
Sequence:CCGGCCAGACCTCTATATTGAGATTCTCGAGAATCTCAATATAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023328.2-914s21c1
Sequence:CCGGCGGCATAGAAACATGCTCATTCTCGAGAATGAGCATGTTTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-892s21c1
Sequence:CCGGAGATTGGCACCGGCATGATAACTCGAGTTATCATGCCGGTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023328.2-4100s21c1
Sequence:CCGGTAAATTCAGTGTGTCCGAATACTCGAGTATTCGGACACACTGAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023328.2-434s21c1
Sequence:CCGGGCGAGTTTCTTAGTTGCCAAACTCGAGTTTGGCAACTAAGAAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015239
VALIDATED
AGTPBP1 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-3906s1c1
Sequence:CCGGCCTGAGTATCATTGCATGAATCTCGAGATTCATGCAATGATACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-2927s1c1
Sequence:CCGGCCGGATTTACATCCTACAATTCTCGAGAATTGTAGGATGTAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015239.1-1936s1c1
Sequence:CCGGGCCTCCATTCAAAGAGCCTATCTCGAGATAGGCTCTTTGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-1937s1c1
Sequence:CCGGCCTCCATTCAAAGAGCCTATTCTCGAGAATAGGCTCTTTGAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015239.1-1573s1c1
Sequence:CCGGCCGAATTACATTGCAGAATATCTCGAGATATTCTGCAATGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-2041s21c1
Sequence:CCGGCATGACCCAGACCTCTATATTCTCGAGAATATAGAGGTCTGGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-4126s21c1
Sequence:CCGGTTTATCTCCCTATGGTTATATCTCGAGATATAACCATAGGGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-2847s21c1
Sequence:CCGGAGCAATGCCAGAGTCTAATTACTCGAGTAATTAGACTCTGGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015239.2-1050s21c1
Sequence:CCGGAGATTGGCACCGCCATGATAACTCGAGTTATCATGGCGGTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-3463s21c1
Sequence:CCGGTATACCATGGAGAGTACTTTACTCGAGTAAAGTACTCTCCATGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015239
VALIDATED
AGTPBP1 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-3906s1c1
Sequence:CCGGCCTGAGTATCATTGCATGAATCTCGAGATTCATGCAATGATACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-2927s1c1
Sequence:CCGGCCGGATTTACATCCTACAATTCTCGAGAATTGTAGGATGTAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015239.1-1936s1c1
Sequence:CCGGGCCTCCATTCAAAGAGCCTATCTCGAGATAGGCTCTTTGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-1937s1c1
Sequence:CCGGCCTCCATTCAAAGAGCCTATTCTCGAGAATAGGCTCTTTGAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015239.1-1573s1c1
Sequence:CCGGCCGAATTACATTGCAGAATATCTCGAGATATTCTGCAATGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-2041s21c1
Sequence:CCGGCATGACCCAGACCTCTATATTCTCGAGAATATAGAGGTCTGGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-4126s21c1
Sequence:CCGGTTTATCTCCCTATGGTTATATCTCGAGATATAACCATAGGGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-2847s21c1
Sequence:CCGGAGCAATGCCAGAGTCTAATTACTCGAGTAATTAGACTCTGGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015239.2-1050s21c1
Sequence:CCGGAGATTGGCACCGCCATGATAACTCGAGTTATCATGGCGGTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-3463s21c1
Sequence:CCGGTATACCATGGAGAGTACTTTACTCGAGTAAAGTACTCTCCATGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015239
VALIDATED
AGTPBP1 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-3906s1c1
Sequence:CCGGCCTGAGTATCATTGCATGAATCTCGAGATTCATGCAATGATACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-2927s1c1
Sequence:CCGGCCGGATTTACATCCTACAATTCTCGAGAATTGTAGGATGTAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015239.1-1936s1c1
Sequence:CCGGGCCTCCATTCAAAGAGCCTATCTCGAGATAGGCTCTTTGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015239.1-1937s1c1
Sequence:CCGGCCTCCATTCAAAGAGCCTATTCTCGAGAATAGGCTCTTTGAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015239.1-1573s1c1
Sequence:CCGGCCGAATTACATTGCAGAATATCTCGAGATATTCTGCAATGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-2041s21c1
Sequence:CCGGCATGACCCAGACCTCTATATTCTCGAGAATATAGAGGTCTGGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-4126s21c1
Sequence:CCGGTTTATCTCCCTATGGTTATATCTCGAGATATAACCATAGGGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-2847s21c1
Sequence:CCGGAGCAATGCCAGAGTCTAATTACTCGAGTAATTAGACTCTGGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015239.2-1050s21c1
Sequence:CCGGAGATTGGCACCGCCATGATAACTCGAGTTATCATGGCGGTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015239.2-3463s21c1
Sequence:CCGGTATACCATGGAGAGTACTTTACTCGAGTAAAGTACTCTCCATGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks